China Oncology ›› 2024, Vol. 34 ›› Issue (2): 176-184.doi: 10.19401/j.cnki.1007-3639.2024.02.005
• Article • Previous Articles Next Articles
CHEN Yuanxiang(
), YU Tao, YANG Shiyu, ZENG Tao, WEI Lan, ZHANG Yan(
)
Received:2023-09-19
Revised:2023-12-18
Online:2024-02-29
Published:2024-03-14
Contact:
ZHANG Yan
Share article
CLC Number:
CHEN Yuanxiang, YU Tao, YANG Shiyu, ZENG Tao, WEI Lan, ZHANG Yan. KDM4A promotes the migration and invasion of breast cancer cell line MDA-MB-231 by downregulating BMP9[J]. China Oncology, 2024, 34(2): 176-184.
Tab. 1
Sequences of siRNA and RTFQ-PCR primer"
| Primer | Sequence (5'→3') |
|---|---|
| siRNA negative control | F: UUCUCCGAACGUGUCACGUTT |
| R: ACGUGACACGUUCGGAGAATT | |
| siKDM4A | F: CCGAGUUUGUCUUGAAAUATT |
| R: UAUUUCAAGACAAACUCGGTT | |
| BMP9 | F: CGTCCAACATTGTGCGGAG |
| R: GACAGGAGACATAGAGTCGGAG | |
| KDM4A | F: CCTCACTGCGCTGTCTGTAT |
| R: CCAGTCGAAGTGAAGCACAT | |
| GAPDH | F: CAGCGACACCCACTCCTC |
| R: TGAGGTCCACCACCCTGT |
Fig. 1
KDM4A highly expressed in breast cancer A, B: High expression of KDM4A in breast cancer; C: Expression of KDM4A in different stages of breast cancer; D: The expression of KDM4A in breast cancer cells were detected by RTFQ-PCR; E: The expression of KDM4A in breast cancer cells was detected by Western blot. *: P<0.05, tumor vs normal; ***: P<0.001, compared with MCF-10A."
Fig. 2
The expression of KDM4A is negatively correlated with BMP9 A-C: The expression of KDM4A and BMP9 in HNSC, KIRC and BRCA; D: Knocking down KDM4A significantly increased the mRNA expression of BMP9 in MDA-MB-231; E: Knocking down KDM4A significantly increased the protein expression of BMP9 in MDA-MB-231. ***: P<0.001, compared with NC group. NC: Normal control."
Fig. 3
KDM4A downregulatd histone methylation status A: Knocking down KDM4A upregulates H3K36 and H3K4 methylation levels; B: ChIP detection of H3K36me3 and H3K4me3 enrichment in the BMP9 promoter region in MDA-MB-231 cells. ***: P<0.001, compared with NC group. NC: Normal control; ns: No significance."
Fig.5
Silencing of KDM4A inhibited the migration and invasion of breast cancer cells A: The migration ability of MDA-MB-231 was detected by wound healing test; B: The migration and invasion ability of MDA-MB-231 was detected by transwell assay. ***: P<0.001, compared with NC group. NC: Normal control."
| [1] |
HOUGHTON S C, HANKINSON S E. Cancer progress and priorities: breast cancer[J]. Cancer Epidemiol Biomarkers Prev, 2021, 30(5): 822-844.
doi: 10.1158/1055-9965.EPI-20-1193 |
| [2] |
BARZAMAN K, KARAMI J, ZAREI Z, et al. Breast cancer: biology, biomarkers, and treatments[J]. Int Immunopharmacol, 2020, 84: 106535.
doi: 10.1016/j.intimp.2020.106535 |
| [3] | LANDSKRON G, DE LA FUENTE M, THUWAJIT P, et al. Chronic inflammation and cytokines in the tumor microenvironment[J]. J Immunol Res, 2014, 2014: 149185. |
| [4] |
KONG R N, GAO J, JI L M, et al. Iguratimod ameliorates rheumatoid arthritis progression through regulating miR-146a mediated IRAK1 expression and TRAF6/JNK1 pathway: an in vivo and in vitro study[J]. Clin Exp Rheumatol, 2021, 39(2): 289-303.
doi: 10.55563/clinexprheumatol/urhbn0 |
| [5] | 谭秋芬, 胡惠军. FEN1、GTF2IP23、KDM4A在乳腺癌组织中的表达研究[J]. 国际检验医学杂志, 2023, 44(3): 311-315. |
| TAN Q F, HU H J. Expression and correlation of FEN1, GTF2IP23, and KDM4A in breast cancer tissues[J]. Int J Lab Med, 2023, 44(3): 311-315. | |
| [6] |
LEE J, THOMPSON J R, BOTUYAN M V, et al. Distinct binding modes specify the recognition of methylated histones H3K4 and H4K20 by JMJD2A-tudor[J]. Nat Struct Mol Biol, 2008, 15(1): 109-111.
doi: 10.1038/nsmb1326 pmid: 18084306 |
| [7] | CHEN Y C, LIU X R, LI Y K, et al. Lung cancer therapy targeting histone methylation: opportunities and challenges[J]. Comput Struct Biotechnol J, 2018, 16: 211-223. |
| [8] |
WANG G L, WEN B Q, DENG Z C, et al. Endothelial progenitor cells stimulate neonatal lung angiogenesis through FOXF1-mediated activation of BMP9/ACVRL1 signaling[J]. Nat Commun, 2022, 13(1): 2080.
doi: 10.1038/s41467-022-29746-y pmid: 35440116 |
| [9] |
XU J Z, ZHOU Y M, ZHANG L L, et al. BMP9 reduces age-related bone loss in mice by inhibiting osteoblast senescence through Smad1-Stat1-P21 axis[J]. Cell Death Discov, 2022, 8(1): 254.
doi: 10.1038/s41420-022-01048-8 |
| [10] |
HAN Y L, PAN Q Z, GUO Z X, et al. BMP9-induced vascular normalisation improves the efficacy of immunotherapy against hepatitis B virus-associated hepatocellular carcinoma[J]. Clin Transl Med, 2023, 13(5): e1247.
doi: 10.1002/ctm2.1247 pmid: 37132170 |
| [11] |
CHEN H, NIO K, TANG H, et al. BMP9-ID1 signaling activates HIF-1α and VEGFA expression to promote tumor angiogenesis in hepatocellular carcinoma[J]. Int J Mol Sci, 2022, 23(3): 1475.
doi: 10.3390/ijms23031475 |
| [12] |
YU H M, CHEN Y X, LANG L, et al. BMP9 promotes autophagy and inhibits migration and invasion in breast cancer cells through the c-Myc/SNHG3/mTOR signaling axis[J]. Tissue Cell, 2023, 82: 102073.
doi: 10.1016/j.tice.2023.102073 |
| [13] |
WANG W, WENG Y G, REN W, et al. Biological roles of human bone morphogenetic protein 9 in the bone microenvironment of human breast cancer MDA-MB-231 cells[J]. Am J Transl Res, 2015, 7(9): 1660-1674.
pmid: 26550465 |
| [14] |
WANG T, ZHANG Z H, WANG K, et al. Inhibitory effects of BMP9 on breast cancer cells by regulating their interaction with pre-adipocytes/adipocytes[J]. Oncotarget, 2017, 8(22): 35890-35901.
doi: 10.18632/oncotarget.16271 pmid: 28415788 |
| [15] |
REN W, SUN X X, WANG K, et al. BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression[J]. Mol Biol Rep, 2014, 41(3): 1373-1383.
doi: 10.1007/s11033-013-2982-8 pmid: 24413988 |
| [16] |
LI S, DAI H Y, HE Y, et al. BMP9 inhibits the growth of breast cancer cells by downregulation of the PI3K/Akt signaling pathway[J]. Oncol Rep, 2018, 40(3): 1743-1751.
doi: 10.3892/or.2018.6572 pmid: 30015950 |
| [17] |
OUARNÉ M, BOUVARD C, BONEVA G, et al. BMP9, but not BMP10, acts as a quiescence factor on tumor growth, vessel normalization and metastasis in a mouse model of breast cancer[J]. J Exp Clin Cancer Res, 2018, 37(1): 209.
doi: 10.1186/s13046-018-0885-1 pmid: 30165893 |
| [18] |
NEVES REBELLO ALVES L, DUMMER MEIRA D, POPPE MERIGUETI L, et al. Biomarkers in breast cancer: An old story with a new end[J]. Genes, 2023, 14(7): 1364.
doi: 10.3390/genes14071364 |
| [19] |
RANDO O J, CHANG H Y. Genome-wide views of chromatin structure[J]. Annu Rev Biochem, 2009, 78: 245-271.
doi: 10.1146/annurev.biochem.78.071107.134639 pmid: 19317649 |
| [20] | WEI C, DENG X G, GAO S D, et al. Cantharidin inhibits proliferation of liver cancer by inducing DNA damage via KDM4A-dependent histone H3K36 demethylation[J]. Evid Based Complement Alternat Med, 2022, 2022: 2197071. |
| [21] |
SUN S S, YANG F J, ZHU Y C, et al. RETRACTED: KDM4A promotes the growth of non-small cell lung cancer by mediating the expression of Myc via DLX5 through the Wnt/β-catenin signaling pathway[J]. Life Sci, 2020, 262: 118508.
doi: 10.1016/j.lfs.2020.118508 |
| [22] |
CHEN M, JIANG Y H, SUN Y B. KDM4A-mediated histone demethylation of SLC7A11 inhibits cell ferroptosis in osteosarcoma[J]. Biochem Biophys Res Commun, 2021, 550: 77-83.
doi: 10.1016/j.bbrc.2021.02.137 |
| [23] | XIONG J, NIE M F, FU C, et al. Hypoxia enhances HIF1α transcription activity by upregulating KDM4A and mediating H3K9me3, thus inducing ferroptosis resistance in cervical cancer cells[J]. Stem Cells Int, 2022, 2022: 1608806. |
| [24] | LI Y, WANG Y N, XIE Z, et al. JMJD2A facilitates growth and inhibits apoptosis of cervical cancer cells by downregulating tumor suppressor miR-491-5p[J]. Mol Med Rep, 2019, 19(4): 2489-2496. |
| [25] |
LIN X, QIU W X, XIAO Y Y, et al. MiR-199b-5p suppresses tumor angiogenesis mediated by vascular endothelial cells in breast cancer by targeting ALK1[J]. Front Genet, 2019, 10: 1397.
doi: 10.3389/fgene.2019.01397 pmid: 32082362 |
| [26] |
REN W, LIU Y H, WAN S H, et al. BMP9 inhibits proliferation and metastasis of HER2-positive SK-BR-3 breast cancer cells through ERK1/2 and PI3K/AKT pathways[J]. PLoS One, 2014, 9(5): e96816.
doi: 10.1371/journal.pone.0096816 |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
沪ICP备12009617
Powered by Beijing Magtech Co. Ltd