The research on construction of the spontaneous prostate tumor and breast cancer model of Ptenfl/fl;Trp53fl/fl;Pbsn-iCre+ transgenic mouse

doi:10.19401/j.cnki.1007-3639.2025.08.005

Abstract

Abstract:

Background and purpose: Prostate cancer and breast cancer are highly prevalent malignant tumors, and there occurrence and development are related to the tumor suppressor genes phosphatase and tensin homolog deleted on chremosome ten (Pten) and the transformation related protein 53 gene (Trp53). The loss of function of Trp53 is closely related. The simultaneous loss of the two can accelerate the malignant progression of tumors and induce therapeutic resistance. The gene-edited spontaneous tumor model of mice based on the Cre-loxP system is a key tool for studying the mechanism of cancer. Studies have shown that prostate-specific promoter (probasin, Pbsn)-driven iCre recombinase (Pbsn-iCre) can induce spontaneous prostate cancer in male mice, but its role in female breast cancer and transgender expression characteristics have not yet been clarified. In this study, we constructed Pten^fl/fl;Trp53^fl/fl; Pbsn-iCre⁺ transgenic mouse model which was designed to explore its spontaneous tumor phenotype in prostate cancer and breast cancer, and to verify the expression characteristics of Pbsn in breast tissue. Methods: The Pten^fl/fl;Trp53^fl/fl; Pbsn-iCre⁺ mouse model was established using Cre-loxP system by hybridization and continuous backcross screening with Pten^fl/fl mouse, Trp53^fl/fl mouse, and Pbsn-iCre⁺ mouse (Ethical No.: FUSCC-IACUC-2025115). Pten, Trp53 and Pbsn-iCre genotypes were verified by polymerase chain reaction and agarose gel electrophoresis. The incidence of tumor in transgenic mice was monitored, and the histopathological characteristics of tumor were evaluated by hematoxylin-eosin staining. The protein levels of Pten and p53 in prostate and breast tumor tissues were analyzed by immunohistochemistry, and the distributions of Pbsn in breast, prostate, ovary, heart, liver and kidney were detected. Results: Pten^{fl/ fl};Trp53^fl/fl;Pbsn-iCre⁺ male mouse developed spontaneous prostate tumor at age of 5 month, and female mouse developed spontaneous breast tumor at age of 6 months. The pathological manifestations of prostate cancer were invasive acinar adenocarcinoma structure with glandular structure disorder and basement membrane destruction. The pathological manifestations of breast cancer were invasive ductal carcinoma with ductal epithelial dysplasia and interstitial lymphocyte infiltration. Immunohistochemistry confirmed the complete deletion of Pten and p53 proteins in prostate and breast tumor tissues, which verified the prostate and mammary gland specific gene knockout effect. Immunohistochemistry also confirmed that Pbsn protein was specifically expressed in prostate acinar epithelial cells, ovarian tissue, and mammary duct epithelial cells, but not in heart, liver and kidney. Conclusion: Pbsn-iCre is functionally expressed in female mammary glands, and the simultaneous loss of Pten/Trp53 induced by Pbsn-iCre may drive the development of prostate cancer in male and breast cancer in female mouse.

Key words: Transgenic mouse spontaneous tumor model, Pbsn-iCre, Pten/Trp53 double deletion, Prostate cancer, Breast cancer

CLC Number:

WU Jiachen, HE Lina, TANG Xinru, TANG Shuang. The research on construction of the spontaneous prostate tumor and breast cancer model of Pten^fl/fl;Trp53^fl/fl;Pbsn-iCre⁺ transgenic mouse[J]. China Oncology, 2025, 35(8): 769-775.

Figures/Tables 4

Tab. 1

Fig. 1

Fig. 2

Fig. 3

References 19

[1]	SIEGEL R L, KRATZER T B, GIAQUINTO A N, et al. Cancer statistics, 2025[J]. CA A Cancer J Clinicians, 2025, 75(1): 10-45.
[2]	BERGHOLZ J S, WANG Q W, WANG Q, et al. PI3Kβ controls immune evasion in PTEN-deficient breast tumours[J]. Nature, 2023, 617(7959): 139-146.
[3]	MÜLLER M, MAY S, HALL H, et al. Human-correlated genetic models identify precision therapy for liver cancer[J]. Nature, 2025, 639(8055): 754-764.
[4]	RASOOL R U, O’CONNOR C M, DAS C K, et al. Loss of LCMT1 and biased protein phosphatase 2A heterotrimerization drive prostate cancer progression and therapy resistance[J]. Nat Commun, 2023, 14(1): 5253. doi: 10.1038/s41467-023-40760-6 pmid: 37644036
[5]	PORTALE F, CARRIERO R, IOVINO M, et al. C/EBPβ-dependent autophagy inhibition hinders NK cell function in cancer[J]. Nat Commun, 2024, 15(1): 10343.
[6]	CHENG C P, WANG J M, XU P H, et al. Gremlin1 is a therapeutically targetable FGFR1 ligand that regulates lineage plasticity and castration resistance in prostate cancer[J]. Nat Cancer, 2022, 3(5): 565-580.
[7]	SHI W, WANG Y, ZHAO Y H, et al. Immune checkpoint B7-H3 is a therapeutic vulnerability in prostate cancer harboring PTEN and TP53deficiencies[J]. Sci Transl Med, 2023, 15(695): eadf6724.
[8]	HU Z Y, TANG M, HUANG Y J, et al. SIRT7 facilitates endometrial cancer progression by regulating PTEN stability in an estrogen-dependent manner[J]. Nat Commun, 2025, 16(1): 2989.
[9]	WELLENSTEIN M D, COFFELT S B, DUITS D E M, et al. Loss of p53 triggers WNT-dependent systemic inflammation to drive breast cancer metastasis[J]. Nature, 2019, 572(7770): 538-542.
[10]	THOENEN E, RANJAN A, PARRALES A, et al. Suppression of stress granule formation is a vulnerability imposed by mutant p53[J]. Nat Commun, 2025, 16(1): 2365.
[11]	YANUSHKO D, GERMAN FALCON B, EL BIZRI R, et al. p53-loss induced prostatic epithelial cell plasticity and invasion is driven by a crosstalk with the tumor microenvironment[J]. Cell Death Dis, 2025, 16(1): 46. doi: 10.1038/s41419-025-07361-1 pmid: 39865080
[12]	SAILER V, VON AMSBERG G, DUENSING S, et al. Experimental in vitro, ex vivo and in vivo models in prostate cancer research[J]. Nat Rev Urol, 2023, 20(3): 158-178.
[13]	JI Y Y, ZHANG W W, SHEN K, et al. The ELAVL3/MYCN positive feedback loop provides a therapeutic target for neuroendocrine prostate cancer[J]. Nat Commun, 2023, 14(1): 7794. doi: 10.1038/s41467-023-43676-3 pmid: 38016952
[14]	LI D, ZHAN Y, WANG N T, et al. ETV4 mediates dosage-dependent prostate tumor initiation and cooperates with p53 loss to generate prostate cancer[J]. Sci Adv, 2023, 9(14): eadc9446.
[15]	WU X, WU J, HUANG J, et al. Generation of a prostate epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation[J]. Mech Dev, 2001, 101(1/2): 61-69.
[16]	CHAUDAGAR K, HIEROMNIMON H M, KHURANA R, et al. Reversal of lactate and PD-1-mediated macrophage immunosuppression controls growth of PTEN/p53-deficient prostate cancer[J]. Clin Cancer Res, 2023, 29(10): 1952-1968.
[17]	GHISONI E, MOROTTI M, SARIVALASIS A, et al. Immunotherapy for ovarian cancer: towards a tailored immunophenotype-based approach[J]. Nat Rev Clin Oncol, 2024, 21(11): 801-817. doi: 10.1038/s41571-024-00937-4 pmid: 39232212
[18]	ZHENG Y Q, YU K, LIN J F, et al. Deep learning prioritizes cancer mutations that alter protein nucleocytoplasmic shuttling to drive tumorigenesis[J]. Nat Commun, 2025, 16(1): 2511.
[19]	HAUSEMAN Z J, STAUFFER F, BEYER K S, et al. Targeting the SHOC2-RAS interaction in RAS-mutant cancers[J]. Nature, 2025, 642(8066): 232-241.

Gene primer	Sequence (5’-3’)	Product size/bp
Pten
Forward	CAAGCACTCTGCGAACTGAG	WT: 156 Targeted: 328
Reverse	AAGTTTTTGAAGGCAAGATGC	WT: 156 Targeted: 328
Trp53
Forward	AGCACATAGGAGGCAGAGAC	WT: 288 Targeted: 370
Reverse	CACAAAAACAGGTTAAACCCAG	WT: 288 Targeted: 370
Pbsn-iCre
5’-forward	GGGCAGTCTGGTACTTCCAAGCT	WT: 0 Targeted: 453
5’-reverse	TGGACAATGCCCAATGCCTG	WT: 0 Targeted: 453
WT-forward	CAGCAAAACCTGGCTGTGGATC	WT: 412 Targeted: 0
WT-reverse	ATGAGCCACCATGTGGGTGTC	WT: 412 Targeted: 0