LncRNA DLEU7-AS1 contributes to proliferation and migration of gastric cancer by regulating MSN transcription

doi:10.19401/j.cnki.1007-3639.2023.04.003

Abstract

Abstract:

Background and purpose: An increasing number of studies have demonstrated that lncRNA plays a critical role in the occurrence and development of tumors. However, the function of lncRNA in human gastric cancer remains largely unknown. So far, the role and mechanism of lncRNA DLEU7-AS1 in gastric cancer have not been reported. This study aimed to investigate the effect of DLEU7-AS1on the tumorigenesis and progression of gastric cancer and its mechanism. Methods: The public database the Cancer Genome Atlas (TCGA) was used to analyze the expression of DLEU7-AS1 in gastric cancer tissues and the correlation between its expression and the survival of gastric cancer patients. Then real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR) was performed to verify the expression of DLEU7-AS1 in gastric cancer tissues and gastric cancer cell lines. Gastric cancer cell lines were treated with 5-aza-2’-deoxycytidine (DAC) and trichostatin A (TSA) to explore whether epigenetic regulation participated in DLEU7-AS1 transcription. SiRNA was used to down-regulate the expression of DLEU7-AS1 in HGC-27 and AGS cells, and recombinant plasmid was used to up-regulate the expression of DLEU7-AS1 in MGC-803 and MKN-45. The effect was verified by RTFQ-PCR. Cell biological experiments, such as cell counting kit-8 (CCK-8) cell proliferation toxicity test, transwell chamber assay, plate colony formation assay and flow cytometry were used to investigate the effect of DLEU7-AS1 on the proliferation, migration, apoptosis and cell cycle progression of gastric cancer cells. RNA sequencing (RNA-seq) was used to analyze downstream signal pathways after silencing DLEU7-AS1 and tested by RTFQ-PCR and Western blot. And RNA Co-immunoprecipitation (RIP) was used to explore the regulatory mechanism of DLEU7-AS1 on downstream signal molecules. Results: The results of public database analysis and RTFQ-PCR demonstrated that DLEU7-AS1 was up-regulated in gastric cancer tissues compared with normal tissues. DLEU7-AS1 expression was negatively correlated with the survival of gastric cancer patients. DLEU7-AS1 was up-regulated in gastric cancer cell lines treated with DAC and TSA, indicating that its expression was epigenetically regulated. DLEU7-AS1 downregulation inhibited gastric cancer cells proliferation and migration and promoted cell apoptosis, while overexpression of DLEU7-AS1 promoted cell proliferation and metastasis and inhibited cell apoptosis. The results of RNA-seq showed that the downregulation of DLEU7-AS1 expression led to a significant decrease in moesin (MSN) expression, which was confirmed by RTFQ-PCR and Western blot. Rescue experiment results further verified that MSN overexpression could partially restore the inhibition effect of knockdown of DLEU7-AS1 on the proliferation and migration of gastric cancer cells. Considering that DLEU7-AS1 mainly located in the nucleus, DLEU7-AS1 binding to P300 and H3K27 highly enriched near the MSN promoter, it was proposed that DLEU7-AS1 might regulate the expression of MSN by recruiting P300, thus contributing to the proliferation and migration of gastric cancer cells. Conclusion: LncRNA DLEU7-AS1 is abnormally up-regulated in gastric cancer and negatively correlated with survival of gastric cancer patients. DLEU7-AS1 may promote the proliferation and migration of gastric cancer by recruiting P300 to regulate the transcription of MSN, which provides a new idea for the diagnosis and treatment of gastric cancer..

Key words: Gastric cancer, DLEU7-AS1, Moesin, Epigenetic regulation, Proliferation, Migration

CLC Number:

R735.2

XIAO Lanshu, PAN Liudi, LIU Yi, WANG Jie, CHEN Hui. LncRNA DLEU7-AS1 contributes to proliferation and migration of gastric cancer by regulating MSN transcription[J]. China Oncology, 2023, 33(4): 327-341.

Figures/Tables 16

Tab. 1

Tab. 2

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Fig. 8

Fig. 9

Fig. 10

Fig. 11

Fig. 12

Fig. 13

Fig. 14

References 29

[1]	SUNG H, FERLAY J, SIEGEL R L, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-249. doi: 10.3322/caac.v71.3
[2]	SMYTH E C, NILSSON M, GRABSCH H I, et al. Gastric cancer[J]. The Lancet, 2020, 396(10251): 635-648. doi: 10.1016/S0140-6736(20)31288-5
[3]	QIU H B, CAO S M, XU R H. Cancer incidence, mortality, and burden in China: a time-trend analysis and comparison with the United States and United Kingdom based on the global epidemiological data released in 2020[J]. Cancer Commun, 2021, 41(10): 1037-1048. doi: 10.1002/cac2.v41.10
[4]	CHEN W Q, ZHENG R S, BAADE P D, et al. Cancer statistics in China, 2015[J]. CA A Cancer J Clin, 2016, 66(2): 115-132. doi: 10.3322/caac.21338
[5]	XIA C F, DONG X S, LI H, et al. Cancer statistics in China and United States, 2022: profiles, trends, and determinants[J]. Chin Med J (Engl), 2022, 135(5): 584-590.
[6]	HERMAN A B, TSITSIPATIS D, GOROSPE M. Integrated lncRNA function upon genomic and epigenomic regulation[J]. Mol Cell, 2022, 82(12): 2252-2266. doi: 10.1016/j.molcel.2022.05.027 pmid: 35714586
[7]	HUARTE M. The emerging role of lncRNAs in cancer[J]. Nat Med, 2015, 21(11): 1253-1261. doi: 10.1038/nm.3981 pmid: 26540387
[8]	TAN Y T, LIN J F, LI T, et al. LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer[J]. Cancer Commun (Lond), 2021, 41(2): 109-120.
[9]	JUSIC A, THOMAS P B, WETTINGER S B, et al. Noncoding RNAs in age-related cardiovascular diseases[J]. Ageing Res Rev, 2022, 77: 101610. doi: 10.1016/j.arr.2022.101610
[10]	SUN P, HAMBLIN M H, YIN K J. Non-coding RNAs in the regulation of blood-brain barrier functions in central nervous system disorders[J]. Fluids Barriers CNS, 2022, 19(1): 27. doi: 10.1186/s12987-022-00317-z pmid: 35346266
[11]	LIU X B, HAN C, SUN C Z. Long non-coding RNA DLEU7-AS1 promotes the occurrence and development of colorectal cancer via Wnt/β-catenin pathway[J]. Eur Rev Med Pharmacol Sci, 2018, 22(1): 110-117.
[12]	WANG X J, CHEN L, XU R, et al. DLEU7-AS1 promotes renal cell cancer by silencing the miR-26a-5p/coronin-3 axis[J]. Clin Kidney J, 2022, 15(8): 1542-1552. doi: 10.1093/ckj/sfac061
[13]	WANG C Z, MA B B, XU Z J, et al. Reduced expression of lncRNA DLEU7-AS1 is a novel favorable prognostic factor in acute myeloid leukemia[J]. Biosci Rep, 2022, 42(5): BSR20212078.
[14]	ENCODE PROJECT CONSORTIUM. An integrated encyclopedia of DNA elements in the human genome[J]. Nature, 2012, 489(7414): 57-74. doi: 10.1038/nature11247
[15]	HUANG W X, LI H, YU Q S, et al. LncRNA-mediated DNA methylation: an emerging mechanism in cancer and beyond[J]. J Exp Clin Cancer Res, 2022, 41(1): 100. doi: 10.1186/s13046-022-02319-z
[16]	LI K, WANG Z Q. lncRNA NEAT1: key player in neurodegenerative diseases[J]. Ageing Res Rev, 2023, 86: 101878. doi: 10.1016/j.arr.2023.101878
[17]	NOJIMA T, PROUDFOOT N J. Mechanisms of lncRNA biogenesis as revealed by nascent transcriptomics[J]. Nat Rev Mol Cell Biol, 2022, 23(6): 389-406.
[18]	LIU J, LIU Z X, WU Q N, et al. Long noncoding RNA AGPG regulates PFKFB3-mediated tumor glycolytic reprogramming[J]. Nat Commun, 2020, 11(1): 1507. doi: 10.1038/s41467-020-15112-3 pmid: 32198345
[19]	JI X S, LIU Z H, GAO J J, et al. N6-Methyladenosine-modified lncRNA LINREP promotes glioblastoma progression by recruiting the PTBP1/HuR complex[J]. Cell Death Differ, 2023, 30(1): 54-68. doi: 10.1038/s41418-022-01045-5
[20]	MCCABE E M, RASMUSSEN T P. lncRNA involvement in cancer stem cell function and epithelial-mesenchymal transitions[J]. Semin Cancer Biol, 2021, 75: 38-48. doi: 10.1016/j.semcancer.2020.12.012 pmid: 33346133
[21]	LIU H, LI D X, SUN L N, et al. Interaction of lncRNA MIR100HG with hnRNPA2B1 facilitates m6A-dependent stabilization of TCF7L2 mRNA and colorectal cancer progression[J]. Mol Cancer, 2022, 21(1): 74. doi: 10.1186/s12943-022-01555-3
[22]	LI Z, LANG Z Q, WANG T, et al. LncRNA SNHG22 promotes gastric cancer progression by regulating the miR-101-3p/e2f2 axis[J]. Cell Cycle, 2023, 22(3): 347-360. doi: 10.1080/15384101.2022.2119515
[23]	LIN Z H, SONG J L, GAO Y K, et al. Hypoxia-induced HIF-1α/lncRNA-PMAN inhibits ferroptosis by promoting the cytoplasmic translocation of ELAVL1 in peritoneal dissemination from gastric cancer[J]. Redox Biol, 2022, 52: 102312. doi: 10.1016/j.redox.2022.102312
[24]	MANGEAT P, ROY C, MARTIN M. ERM proteins in cell adhesion and membrane dynamics[J]. Trends Cell Biol, 1999, 9(5): 187-192. pmid: 10322453
[25]	DEGRYSE B, BRITTO M, SHAN C X, et al. Moesin and merlin regulate urokinase receptor-dependent endothelial cell migration, adhesion and angiogenesis[J]. Int J Biochem Cell Biol, 2017, 88: 14-22. doi: S1357-2725(17)30090-0 pmid: 28473293
[26]	LI Y Q, ZHENG Z, LIU Q X, et al. Moesin as a prognostic indicator of lung adenocarcinoma improves prognosis by enhancing immune lymphocyte infiltration[J]. World J Surg Oncol, 2021, 19(1): 109. doi: 10.1186/s12957-021-02229-y
[27]	SUN X, LI K X, HASE M, et al. Suppression of breast cancer-associated bone loss with osteoblast proteomes via Hsp90ab1/moesin-mediated inhibition of TGFβ/FN1/CD44 signaling[J]. Theranostics, 2022, 12(2): 929-943. doi: 10.7150/thno.66148 pmid: 34976221
[28]	YU L F, ZHAO L, WU H Z, et al. Moesin is an independent prognostic marker for ER-positive breast cancer[J]. Oncol Lett, 2019, 17(2): 1921-1933. doi: 10.3892/ol.2018.9799 pmid: 30675256
[29]	KAMIOKA H, TOMONO T, FUJITA A, et al. Moesin-mediated P-glycoprotein activation during snail-induced epithelial-mesenchymal transition in lung cancer cells[J]. J Pharm Sci, 2020, 109(7): 2302-2308. doi: 10.1016/j.xphs.2020.03.008

Gene	Forward primer (5' to 3')	Reverse primer (5' to 3')
DLEU7-AS1	AGGGGCCACATGGTTCTTTT	AGTTCTCCCTTGCTGCACTC
MSN	CCATGCCCAAAACGATCAGTG	ACCAAACTTCCCTCAAGCCA
GAPDH	GACAGTCAGCCGCATCTTCT	GCGCCCAATACGACCAAATC

SiRNA	Sense (5' to 3')	Antisense (5' to 3')
DLEU7-AS1-491	GCUGCCUACAUUUCAGUAATT	UUACUGAAAUGUAGGCAGCTT
DLEU7-AS1-1602	GCAAGGGAGAACUAAACUATT	UAGUUUAGUUCUCCCUUGCTT
NC	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT