A study on mechanism of lncRNA-mediated SNHG5/miR-26a-5p/MTDH signal axis promoting metastasis of colorectal cancer

doi:10.19401/j.cnki.1007-3639.2023.07.005

Abstract

Abstract:

Background and purpose: Long non-coding RNA small nucleolar RNA host gene 5 (lncRNA SNHG5) plays a cancer-promoting role in many cancers, however its effect on colorectal cancer (CRC) and its regulatory mechanism are not clear. This study aimed to explore the mechanism of lncRNA SNHG5/miR-26a-5p/metadherin (MTDH) signal axis promoting metastasis of CRC. Methods: The data of The Cancer Genome Atlas (TCGA) database was analyzed, the abnormal expression of lncRNA in CRC was explored and analyzed the survival. Samples of CRC, paracancerous tissues and complete clinical data of patients who underwent surgical resection from October 2020 to October 2021 were collected. The expression levels of SNHG5 and miR-26a-5p in lncRNA were detected by real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR), and the expression level of MTDH was detected by immunohistochemistry. The relationship between the relative expression level of lncRNA SNHG5 in CRC and clinicopathological features and survival time was analyzed. The effects of lncRNA SNHG5 on the proliferation, migration and invasion of CRC cells were detected by cell counting kit-8 (CCK-8), clone formation, scratching assays, transwell test and in vivo xenotransplantation. The relationship between CRC cell metastasis, the expression level of epithelial-mesenchymal transition related molecules and lncRNA SNHG5 expression level by Western blot and immunohistochemical detection were explored. The physical interaction between SNHG5 and miR-26a-5p, MTDH and miR-26a-5p was studied by RNA pull-down test, double luciferase reporter gene detection and RNA co-immunoprecipitation. The functional relationship among the three was verified by CCK-8, EdU and transwell experiments. The effect of SNHG5, miR-26a-5p and MTDH expression on migration and invasion related molecules was analyzed by Western blot. Results: The results of TCGA database analysis showed that lncRNA SNHG5 was significantly upregulated in CRC. The results of RTFQ-PCR and immunohistochemistry showed that the levels of lncRNA SNHG5 and MTDH in CRC tissues were significantly upregulated (P<0.05), the level of miR-26a-5p was decreased (P<0.05), and the level of MTDH in samples with high expression of SNHG5 was also increased. The expression of lncRNA SNHG5 in CRC tissues with serosa and extraserosal invasion, distant metastasis, lymph node metastasis and TNM stage Ⅲ was significantly higher compared with subserosal invasion, no distant metastasis and lymph node metastasis and TNM stage Ⅰ-Ⅱ (P<0.05). The results of survival analysis showed that the high expression of lncRNA SNHG5 was significantly correlated with overall survival rate (P<0.05). Overexpression of lncRNA SNHG5 could enhance the proliferation, clone formation, migration and invasion of CRC cells, promote the growth and lung metastasis of transplanted tumor, increase the relative expression level of Ki-67 proliferation index and vimentin (P<0.05), and decrease the relative expression level of E-cadherin (P<0.05). However, the development of CRC cells was inhibited after inhibition of lncRNA SNHG5 expression. RNA pull-down test, double luciferase reporter gene detection and RNA co-immunoprecipitation confirmed the physical interaction between SNHG5 and miR-26a-5p, MTDH and miR-26a-5p. Upregulation of miR-26a-5p or downregulation of MTDH expression in lncRNA SNHG5 overexpressed cells partially reversed the effects of lncRNA SNHG5 on proliferation, migration, invasion and expression of related molecules in CRC cells. Conclusion: LncRNA SNHG5 is upregulated in CRC tissues and cells, and its high expression is related to tumor progression and poor survival. It can be used as a molecular sponge of miR-26a-5p to regulate the expression of MTDH to promote the proliferation and metastasis of SW620 cells.

Key words: Long non-coding RNA small nucleolar RNA host gene 5, miR-26a-5p, Metadherin, Colorectal cancer, Metastasis

CLC Number:

R735.3

YE Junling, ZHENG Xiaoying, GUO Xinjian, CHEN Ruihui, YANG Liu, GOU Xiaodan, JIANG Hanmei. A study on mechanism of lncRNA-mediated SNHG5/miR-26a-5p/MTDH signal axis promoting metastasis of colorectal cancer[J]. China Oncology, 2023, 33(7): 673-685.

Figures/Tables 16

Tab. 1

Fig. 1

Tab. 2

Fig. 2

Fig. 3

Tab. 3

Tab. 4

Fig. 4

Tab. 5

Tab. 6

Fig. 5

Fig. 6

Tab. 7

Fig. 7

Tab. 8

Fig. 8

References 25

[1]	OGUNWOBI O O, MAHMOOD F, AKINGBOYE A. Biomarkers in colorectal cancer: current research and future prospects[J]. Int J Mol Sci, 2020, 21(15): 5311. doi: 10.3390/ijms21155311
[2]	LADABAUM U, DOMINITZ J A, KAHI C, et al. Strategies for colorectal cancer screening[J]. Gastroenterology, 2020, 158(2): 418-432. doi: S0016-5085(19)41185-2 pmid: 31394083
[3]	VACANTE M, CIUNI R, BASILE F, et al. The liquid biopsy in the management of colorectal cancer: an overview[J]. Biomedicines, 2020, 8(9): 308. doi: 10.3390/biomedicines8090308
[4]	SINGH N, EBERHARDT M, WOLKENHAUER O, et al. An integrative network-driven pipeline for systematic identification of lncRNA-associated regulatory network motifs in metastatic melanoma[J]. BMC Bioinformatics, 2020, 21(1): 329. doi: 10.1186/s12859-020-03656-6 pmid: 32703153
[5]	WEI S S, SUN S P, ZHOU X L, et al. SNHG5 inhibits the progression of EMT through the ubiquitin-degradation of MTA2 in oesophageal cancer[J]. Carcinogenesis, 2021, 42(2): 315-326. doi: 10.1093/carcin/bgaa110 pmid: 33095847
[6]	HUANG S L, HUANG Z C, ZHANG C J, et al. LncRNA SNHG5 promotes the glycolysis and proliferation of breast cancer cell through regulating BACH1 via targeting miR-299[J]. Breast Cancer, 2022, 29(1): 65-76. doi: 10.1007/s12282-021-01281-6
[7]	WANG R Q, LONG X R, ZHOU N N, et al. Lnc-GAN1 expression is associated with good survival and suppresses tumor progression by sponging miR-26a-5p to activate PTEN signaling in non-small cell lung cancer[J]. J Exp Clin Cancer Res, 2021, 40(1): 9. doi: 10.1186/s13046-020-01819-0
[8]	CAI Q, WANG C, HUANG L, et al. Long non-coding RNA small nucleolar RNA host gene 5 (SNHG5) regulates renal tubular damage in diabetic nephropathy via targeting miR-26a-5p[J]. Horm Metab Res, 2021, 53(12): 818-824. doi: 10.1055/a-1678-6556 pmid: 34891212
[9]	SHEN M H, XIE S S, ROWICKI M, et al. Therapeutic targeting of metadherin suppresses colorectal and lung cancer progression and metastasis[J]. Cancer Res, 2021, 81(4): 1014-1025. doi: 10.1158/0008-5472.CAN-20-1876 pmid: 33239430
[10]	中华人民共和国国家卫生健康委员会医政医管局, 中华医学会肿瘤学分会. 中国结直肠癌诊疗规范(2020年版)[J]. 中华外科杂志, 2020, 58(8): 601-625.
	Hospital Authority of National Health Commission of the People’s Republic of China; Chinese Society of Oncology, Chinese Medical Association. Chinese protocol of diagnosis and treatment of colorectal cancer (2020 edition)[J]. Chin J Surg, 2020, 58(8): 601-625.
[11]	AGOSTINI F, ZAGALAK J, ATTIG J, et al. Intergenic RNA mainly derives from nascent transcripts of known genes[J]. Genome Biol, 2021, 22(1): 136. doi: 10.1186/s13059-021-02350-x pmid: 33952325
[12]	ZHAO S, GUAN B, MI Y, et al. LncRNA MIR17HG promotes colorectal cancer liver metastasis by mediating a glycolysis-associated positive feedback circuit[J]. Oncogene, 2021, 40(28): 4709-4724. doi: 10.1038/s41388-021-01859-6 pmid: 34145399
[13]	ZHU Y, HU H, YUAN Z, et al. LncRNA NEAT1 remodels chromatin to promote the 5-FU resistance by maintaining colorectal cancer stemness[J]. Cell Death Dis, 2020, 11(11): 962. doi: 10.1038/s41419-020-03164-8 pmid: 33168814
[14]	LI Z J, CHENG J, SONG Y, et al. LncRNA SNHG5 upregulation induced by YY1 contributes to angiogenesis via miR-26b/CTGF/VEGFA axis in acute myelogenous leukemia[J]. Lab Invest, 2021, 101(3): 341-352. doi: 10.1038/s41374-020-00519-9
[15]	GUO Q, DONG L, ZHANG C, et al. MicroRNA-363-3p, negatively regulated by long non-coding RNA small nucleolar RNA host gene 5, inhibits tumor progression by targeting Aurora kinase A in colorectal cancer[J]. Bioengineered, 2022, 13(3): 5357-5372. doi: 10.1080/21655979.2021.2018972 pmid: 35166647
[16]	WANG Z, LIU T, XUE W, et al. ARNTL2 promotes pancreatic ductal adenocarcinoma progression through TGF/BETA pathway and is regulated by miR-26a-5p[J]. Cell Death Dis, 2020, 11(8): 692. doi: 10.1038/s41419-020-02839-6 pmid: 32826856
[17]	KONG W Q, LIANG J J, DU J, et al. Long noncoding RNA DLX6-AS1 regulates the growth and aggressiveness of colorectal cancer cells via mediating the miR-26a/EZH2 axis[J]. Cancer Biother Radiopharm, 2021, 36(9): 753-764.
[18]	YANG Y, XI L, MA Y, et al. The lncRNA small nucleolar RNA host gene 5 regulates trophoblast cell proliferation, invasion, and migration via modulating miR-26a-5p/N-cadherin axis[J]. J Cell Biochem, 2019, 120(3): 3173-3184. doi: 10.1002/jcb.27583 pmid: 30242892
[19]	LI P P, LI R G, HUANG Y Q, et al. LncRNA OTUD6B-AS1 promotes paclitaxel resistance in triple negative breast cancer by regulation of miR-26a-5p/MTDH pathway-mediated autophagy and genomic instability[J]. Aging (Albany NY), 2021, 13(21): 24171-24191.
[20]	KHAN M, SARKAR D. The scope of astrocyte elevated gene-1/metadherin (AEG-1/MTDH) in cancer clinicopathology: a review[J]. Genes (Basel), 2021, 12(2): 308. doi: 10.3390/genes12020308
[21]	CHEN Y Y, HUANG S, GUO R, et al. Metadherin-mediated mechanisms in human malignancies[J]. Biomark Med, 2021, 15(18): 1769-1783. doi: 10.2217/bmm-2021-0298 pmid: 34783585
[22]	KLINGLER J, ANTON H, RÉAL E, et al. How HIV-1 gag manipulates its host cell proteins: a focus on interactors of the nucleocapsid domain[J]. Viruses, 2020, 12(8): E888.
[23]	SETLAI B P, HULL R, REIS R M, et al. MicroRNA interrelated epithelial mesenchymal transition (EMT) in glioblastoma[J]. Genes (Basel), 2022, 13(2): 244. doi: 10.3390/genes13020244
[24]	HE A B, HE S M, HUANG C, et al. MTDH promotes metastasis of clear cell renal cell carcinoma by activating SND1-mediated ERK signaling and epithelial-mesenchymal transition[J]. Aging (Albany NY), 2020, 12(2): 1465-1487.
[25]	ZHANG H, ZOU C, QIU Z, et al. CPEB3-mediated MTDH mRNA translational suppression restrains hepatocellular carcinoma progression[J]. Cell Death Dis, 2020, 11(9): 792. doi: 10.1038/s41419-020-02984-y pmid: 32968053

Gene	Primer sequence (5'-3')
LncRNA SNHG5	Forward: TACTGGCTGCGCACTTCG
	Reverse: CAGTAAAAGGGGAACACCA
miR-26a-5p	Forward: GCTCTGAACGTAGATCCGAAC
	Reverse: GTGCAGGGTCCGAGGT
MTDH	Forward: AGCAAAGCAGCCACCAGAG
	Reverse: AGGAAATGATGCGGTTGTA
U6	Forward: CTCGCTTCGGCAGCACA
	Reverse: AACGCTTCACGAATTTGCGT
GAPDH	Forward: CTCTTCCAGCCTTCCTTCCT
	Reverse: AGCACTGTGTTGGCGTACAG

Characteristic	Case n (%)	LncRNA SNHG5 expression level $\bar{x}±s$	t value	P value
Age/year			0.630	0.530
≥60	56 (56.00)	2.26±0.17
<60	44 (44.00)	2.24±0.14
Gender			0.292	0.771
Male	59 (59.00)	2.25±0.18
Female	41 (41.00)	2.24±0.15
T stage			2.885	0.005
T_1-2	69 (69.00)	2.21±0.17
T_3-4	31 (31.00)	2.32±0.19
N stage			2.908	0.004
N₀	79 (79.00)	2.22±0.18
N₁+N₂	21 (21.00)	2.35±0.19
M stage			2.839	0.005
M₀	80 (80.00)	2.21±0.17
M₁+M₂	20 (20.00)	2.34±0.23
TNM stage			3.823	0.000
Ⅰ-Ⅱ	73 (73.00)	2.17±0.20
Ⅲ	27 (27.00)	2.34±0.19

Group	Tumor volume/mm³ $\bar{x}±s$
Control group	0.35±0.04
si-SNHG5 group	0.11±0.03
SNHG5 group	0.52±0.10
F value	79.215
P value	0.000

Group	Number of lung metastatic nodules $\bar{x}±s$
Control group	23.54±7.46
si-SNHG5 group	10.75±5.09
SNHG5 group	48.52±11.35
F value	41.465
P value	0.000

Group	E-cadherin/GAPDH	Vimentin/GAPDH
Control group	0.90±0.08	1.12±0.09
si-SNHG5 group	1.15±0.09	0.81±0.05
SNHG5 group	0.61±0.07	1.44±0.12
F value	122.283	116.203
P value	0.000	0.000