The feasibility study of FCGBP and BIGH3 in circulating tumor cells as potential markers for colorectal cancer

doi:10.19401/j.cnki.1007-3639.2024.08.004

Abstract

Abstract:

Background and purpose: Colorectal cancer (CRC) is globally recognized as one of the most prevalent malignant tumors. Advanced CRC is marked by a relatively poor prognosis for patients, signifying an urgent need to identify novel potential biomarkers for CRC. A particular focus has been given to circulating tumor cells (CTC), which are cells that have detached from the primary tumor mass and subsequently entered the circulatory system. These cells can be detected within the blood and are currently considered significant potential biomarkers for CRC. This study aimed to investigate if FCGBP and BIGH3 in CRC could be potential markers for colorectal cancer. Methods: This study obtained 3 CRC datasets (GSE74369, GSE117606, and GSE164191) with CTC from the GEO database. Bioinformatics analysis was conducted to screen differentially expressed genes between CTC and normal samples. One dataset that includes clinical information was used for WGCNA analysis, and two key gene modules were identified, containing 1 148 genes in total. Then, functional enrichment analysis was carried out for these genes in the modules. Venn diagrams, PPI network construction analysis, and candidate gene screening were employed. Finally, survival analysis was performed using TCGA and GTEx data in the GEPIAS database, and key genes associated with CRC were identified. The expression of BIGH3 gene was validated in colorectal cancer tissues by real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR), and its association with colorectal cancer was verified through clonogenic, scratch, and transwell assays in HCT116 and SW620 cell lines. Results: Through the analysis of CRC datasets from GEO, we screened a total of 2 214 differential genes. With the help of WGCNA analysis and PPI network construction, 4 CTC-related genes associated with CRC were identified. Survival analysis from the GEPIA database revealed that FCGBP and BIGH3 are associated with overall survival and disease-free survival. Further experiments indicated that BIGH3 gene is overexpressed in 30 matched colorectal cancer samples. The downregulation of BIGH3 expression could slow down cell proliferation and migration rates, as well as decrease invasiveness in HCT116 and SW620 cell lines. In contrast, upregulation of BIGH3 expression could increase its invasiveness or accelerate migration rate. Conclusion: FCGBP and BIGH3 are positively correlated with TNM staging, indicating their pivotal roles in CRC progression. They bear good prognostic value and may serve as potential biological markers for CRC clinically, and could provide potential therapeutic targets. Moreover, our experimental data revealed the crucial role of BIGH3 in colorectal cancer, suggesting it may influence the biological behavior of this disease.

Key words: Colorectal cancer, Circulating tumor cells, Biomarkers

CLC Number:

R735.3+4

GE Zuyin, SONG Kun, LIN Yunxiao, ZHONG Yeling, HAO Jingduo. The feasibility study of FCGBP and BIGH3 in circulating tumor cells as potential markers for colorectal cancer[J]. China Oncology, 2024, 34(8): 745-752.

Figures/Tables 6

Tab. 1

Tab. 2

Fig. 1

Fig. 2

Fig. 3

Fig. 4

References 29

[1]	BRAY F, LAVERSANNE M, SUNG H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-263.
[2]	MASUISHI T, TANIGUCHI H, HAMAUCHI S, et al. Regorafenib versus trifluridine/tipiracil for refractory metastatic colorectal cancer: a retrospective comparison[J]. Clin Colorectal Cancer, 2017, 16(2): e15-e22.
[3]	ZHOU L, WANG J Z, WANG J T, et al. Correlation analysis of MR/CT on colorectal cancer lymph node metastasis characteristics and prognosis[J]. Eur Rev Med Pharmacol Sci, 2017, 21(6): 1219-1225.
[4]	ZHANG J Y, ZHU Z, MIAO Z F, et al. The clinical significance and mechanisms of REG4 in human cancers[J]. Front Oncol, 2020, 10: 559230.
[5]	DOLATKHAH R, DASTGIRI S, EFTEKHAR SADAT A T, et al. Impact of RAS/RAF mutations on clinical and prognostic outcomes in metastatic colorectal cancer[J]. Bioimpacts, 2021, 11(1): 5-14.
[6]	SHEN M Y, ZHANG Z Y, WANG P. GLI3 promotes invasion and predicts poor prognosis in colorectal cancer[J]. Biomed Res Int, 2021, 2021: 8889986.
[7]	YE D X, WANG S S, HUANG Y, et al. USP43 directly regulates ZEB1 protein, mediating proliferation and metastasis of colorectal cancer[J]. J Cancer, 2021, 12(2): 404-416.
[8]	WENG X Y, CHEN W, HU W X, et al. PTPRB promotes metastasis of colorectal carcinoma via inducing epithelial-mesenchymal transition[J]. Cell Death Dis, 2019, 10(5): 352.
[9]	FERREIRA M M, RAMANI V C, JEFFREY S S. Circulating tumor cell technologies[J]. Mol Oncol, 2016, 10(3): 374-394. doi: 10.1016/j.molonc.2016.01.007 pmid: 26897752
[10]	BORK U, RAHBARI N N, SCHÖLCH S, et al. Circulating tumour cells and outcome in non-metastatic colorectal cancer: a prospective study[J]. Br J Cancer, 2015, 112(8): 1306-1313.
[11]	COHEN S J, PUNT C J A, IANNOTTI N, et al. Relationship of circulating tumor cells to tumor response, progression-free survival, and overall survival in patients with metastatic colorectal cancer[J]. J Clin Oncol, 2008, 26(19): 3213-3221. doi: 10.1200/JCO.2007.15.8923 pmid: 18591556
[12]	HUANG X Z, GAO P, SONG Y X, et al. Relationship between circulating tumor cells and tumor response in colorectal cancer patients treated with chemotherapy: a meta-analysis[J]. BMC Cancer, 2014, 14: 976. doi: 10.1186/1471-2407-14-976 pmid: 25519477
[13]	RITCHIE M E, PHIPSON B, WU D, et al. Limma powers differential expression analyses for RNA-sequencing and microarray studies[J]. Nucleic Acids Res, 2015, 43(7): e47.
[14]	LANGFELDER P, HORVATH S. WGCNA: an R package for weighted correlation network analysis[J]. BMC Bioinformatics, 2008, 9: 559. doi: 10.1186/1471-2105-9-559 pmid: 19114008
[15]	YU G C, WANG L G, HAN Y Y, et al. clusterProfiler: an R package for comparing biological themes among gene clusters[J]. OMICS, 2012, 16(5): 284-287. doi: 10.1089/omi.2011.0118 pmid: 22455463
[16]	SZKLARCZYK D, GABLE A L, LYON D, et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets[J]. Nucleic Acids Res, 2019, 47(D1): D607-D613.
[17]	TANG Z F, LI C W, KANG B X, et al. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses[J]. Nucleic Acids Res, 2017, 45(W1): W98-W102.
[18]	QUIROZ-REYES A G, ISLAS J F, DELGADO-GONZALEZ P, et al. Therapeutic approaches for metastases from colorectal cancer and pancreatic ductal carcinoma[J]. Pharmaceutics, 2021, 13(1): 103.
[19]	MIYAMOTO D T, LEE R J, KALINICH M, et al. An RNA-based digital circulating tumor cell signature is predictive of drug response and early dissemination in prostate cancer[J]. Cancer Discov, 2018, 8(3): 288-303. doi: 10.1158/2159-8290.CD-16-1406 pmid: 29301747
[20]	ZHU L, HISSA B, GYŐRFFY B, et al. Characterization of stem-like circulating tumor cells in pancreatic cancer[J]. Diagnostics, 2020, 10(5): 305.
[21]	PENG Y R, XU C X, WEN J, et al. Fatty acid metabolism-related lncRNAs are potential biomarkers for predicting the overall survival of patients with colorectal cancer[J]. Front Oncol, 2021, 11: 704038.
[22]	GILKES D M, SEMENZA G L, WIRTZ D. Hypoxia and the extracellular matrix: drivers of tumour metastasis[J]. Nat Rev Cancer, 2014, 14(6): 430-439. doi: 10.1038/nrc3726 pmid: 24827502
[23]	HANLEY C J, NOBLE F, WARD M, et al. A subset of myofibroblastic cancer-associated fibroblasts regulate collagen fiber elongation, which is prognostic in multiple cancers[J]. Oncotarget, 2016, 7(5): 6159-6174. doi: 10.18632/oncotarget.6740 pmid: 26716418
[24]	RĂCHIERIU C, ENIU D T, MOIŞ E, et al. Lipidomic signatures for colorectal cancer diagnosis and progression using UPLC-QTOF-ESI+MS[J]. Biomolecules, 2021, 11(3): 417.
[25]	CALAF G M, ECHIBURÚ-CHAU C, ZHAO Y L, et al. BigH3 protein expression as a marker for breast cancer[J]. Int J Mol Med, 2008, 21(5): 561-568. pmid: 18425347
[26]	ZHAO Y L, EL-GABRY M, HEI T K. Loss of Betaig-h3 protein is frequent in primary lung carcinoma and related to tumorigenic phenotype in lung cancer cells[J]. Mol Carcinog, 2006, 45(2): 84-92.
[27]	PAN T H, LIN S C, YU K J, et al. BIGH3 promotes osteolytic lesions in renal cell carcinoma bone metastasis by inhibiting osteoblast differentiation[J]. Neoplasia, 2018, 20(1): 32-43. doi: S1476-5586(17)30393-7 pmid: 29190493
[28]	CHIAVARINA B, COSTANZA B, RONCA R, et al. Metastatic colorectal cancer cells maintain the TGFβ program and use TGFBI to fuel angiogenesis[J]. Theranostics, 2021, 11(4): 1626-1640. doi: 10.7150/thno.51507 pmid: 33408771
[29]	PAN X, MA X X. A novel six-gene signature for prognosis prediction in ovarian cancer[J]. Front Genet, 2020, 11: 1006. doi: 10.3389/fgene.2020.01006 pmid: 33193589

Gene	Forward primer (5' to 3')	Reverse primer (5' to 3')
BIGH3	GGGAAGCTCCTTACTGTGGG	CACCCGGGGATGGAACTAAT
GAPDH	GTCTCCTCTGACTTCAACAGCG	ACCACCCTGTTGCTGTAGCCAA

RNA oligos	Sequences
si-NC	Sense: 5'- UUCUCCGAACGUGUCACGUTT -3' Anti-sense: 5'- ACGUGACACGUUCGGAGAATT -3'
si-BIGH3#1	Sense: 5'-GGGACAUGCUCACUAUCAATT -3' Anti-sense: 5'-UUGAUAGUGAGCAUGUCCCTT -3'
si-BIGH3#2	Sense: 5'-GUGCUGUCCUGGAUAUGAATT -3' Anti-sense: 5'- UUCAUAUCCAGGACAGCACTT -3'
si-BIGH3#3	Sense: 5'- AUACGGUUCAAAGUCUCACTT -3' Anti-sense: 5'- GUGAGACUUUGAACCGUAUTT -3'