China Oncology ›› 2024, Vol. 34 ›› Issue (2): 176-184.doi: 10.19401/j.cnki.1007-3639.2024.02.005
• Article • Previous Articles Next Articles
CHEN Yuanxiang(), YU Tao, YANG Shiyu, ZENG Tao, WEI Lan, ZHANG Yan()
Received:
2023-09-19
Revised:
2023-12-18
Online:
2024-02-29
Published:
2024-03-14
Contact:
ZHANG Yan
CLC Number:
CHEN Yuanxiang, YU Tao, YANG Shiyu, ZENG Tao, WEI Lan, ZHANG Yan. KDM4A promotes the migration and invasion of breast cancer cell line MDA-MB-231 by downregulating BMP9[J]. China Oncology, 2024, 34(2): 176-184.
Tab. 1
Sequences of siRNA and RTFQ-PCR primer"
Primer | Sequence (5'→3') |
---|---|
siRNA negative control | F: UUCUCCGAACGUGUCACGUTT |
R: ACGUGACACGUUCGGAGAATT | |
siKDM4A | F: CCGAGUUUGUCUUGAAAUATT |
R: UAUUUCAAGACAAACUCGGTT | |
BMP9 | F: CGTCCAACATTGTGCGGAG |
R: GACAGGAGACATAGAGTCGGAG | |
KDM4A | F: CCTCACTGCGCTGTCTGTAT |
R: CCAGTCGAAGTGAAGCACAT | |
GAPDH | F: CAGCGACACCCACTCCTC |
R: TGAGGTCCACCACCCTGT |
Fig. 1
KDM4A highly expressed in breast cancer A, B: High expression of KDM4A in breast cancer; C: Expression of KDM4A in different stages of breast cancer; D: The expression of KDM4A in breast cancer cells were detected by RTFQ-PCR; E: The expression of KDM4A in breast cancer cells was detected by Western blot. *: P<0.05, tumor vs normal; ***: P<0.001, compared with MCF-10A."
Fig. 2
The expression of KDM4A is negatively correlated with BMP9 A-C: The expression of KDM4A and BMP9 in HNSC, KIRC and BRCA; D: Knocking down KDM4A significantly increased the mRNA expression of BMP9 in MDA-MB-231; E: Knocking down KDM4A significantly increased the protein expression of BMP9 in MDA-MB-231. ***: P<0.001, compared with NC group. NC: Normal control."
Fig. 3
KDM4A downregulatd histone methylation status A: Knocking down KDM4A upregulates H3K36 and H3K4 methylation levels; B: ChIP detection of H3K36me3 and H3K4me3 enrichment in the BMP9 promoter region in MDA-MB-231 cells. ***: P<0.001, compared with NC group. NC: Normal control; ns: No significance."
Fig.5
Silencing of KDM4A inhibited the migration and invasion of breast cancer cells A: The migration ability of MDA-MB-231 was detected by wound healing test; B: The migration and invasion ability of MDA-MB-231 was detected by transwell assay. ***: P<0.001, compared with NC group. NC: Normal control."
[1] |
HOUGHTON S C, HANKINSON S E. Cancer progress and priorities: breast cancer[J]. Cancer Epidemiol Biomarkers Prev, 2021, 30(5): 822-844.
doi: 10.1158/1055-9965.EPI-20-1193 |
[2] |
BARZAMAN K, KARAMI J, ZAREI Z, et al. Breast cancer: biology, biomarkers, and treatments[J]. Int Immunopharmacol, 2020, 84: 106535.
doi: 10.1016/j.intimp.2020.106535 |
[3] | LANDSKRON G, DE LA FUENTE M, THUWAJIT P, et al. Chronic inflammation and cytokines in the tumor microenvironment[J]. J Immunol Res, 2014, 2014: 149185. |
[4] |
KONG R N, GAO J, JI L M, et al. Iguratimod ameliorates rheumatoid arthritis progression through regulating miR-146a mediated IRAK1 expression and TRAF6/JNK1 pathway: an in vivo and in vitro study[J]. Clin Exp Rheumatol, 2021, 39(2): 289-303.
doi: 10.55563/clinexprheumatol/urhbn0 |
[5] | 谭秋芬, 胡惠军. FEN1、GTF2IP23、KDM4A在乳腺癌组织中的表达研究[J]. 国际检验医学杂志, 2023, 44(3): 311-315. |
TAN Q F, HU H J. Expression and correlation of FEN1, GTF2IP23, and KDM4A in breast cancer tissues[J]. Int J Lab Med, 2023, 44(3): 311-315. | |
[6] |
LEE J, THOMPSON J R, BOTUYAN M V, et al. Distinct binding modes specify the recognition of methylated histones H3K4 and H4K20 by JMJD2A-tudor[J]. Nat Struct Mol Biol, 2008, 15(1): 109-111.
doi: 10.1038/nsmb1326 pmid: 18084306 |
[7] | CHEN Y C, LIU X R, LI Y K, et al. Lung cancer therapy targeting histone methylation: opportunities and challenges[J]. Comput Struct Biotechnol J, 2018, 16: 211-223. |
[8] |
WANG G L, WEN B Q, DENG Z C, et al. Endothelial progenitor cells stimulate neonatal lung angiogenesis through FOXF1-mediated activation of BMP9/ACVRL1 signaling[J]. Nat Commun, 2022, 13(1): 2080.
doi: 10.1038/s41467-022-29746-y pmid: 35440116 |
[9] |
XU J Z, ZHOU Y M, ZHANG L L, et al. BMP9 reduces age-related bone loss in mice by inhibiting osteoblast senescence through Smad1-Stat1-P21 axis[J]. Cell Death Discov, 2022, 8(1): 254.
doi: 10.1038/s41420-022-01048-8 |
[10] |
HAN Y L, PAN Q Z, GUO Z X, et al. BMP9-induced vascular normalisation improves the efficacy of immunotherapy against hepatitis B virus-associated hepatocellular carcinoma[J]. Clin Transl Med, 2023, 13(5): e1247.
doi: 10.1002/ctm2.1247 pmid: 37132170 |
[11] |
CHEN H, NIO K, TANG H, et al. BMP9-ID1 signaling activates HIF-1α and VEGFA expression to promote tumor angiogenesis in hepatocellular carcinoma[J]. Int J Mol Sci, 2022, 23(3): 1475.
doi: 10.3390/ijms23031475 |
[12] |
YU H M, CHEN Y X, LANG L, et al. BMP9 promotes autophagy and inhibits migration and invasion in breast cancer cells through the c-Myc/SNHG3/mTOR signaling axis[J]. Tissue Cell, 2023, 82: 102073.
doi: 10.1016/j.tice.2023.102073 |
[13] |
WANG W, WENG Y G, REN W, et al. Biological roles of human bone morphogenetic protein 9 in the bone microenvironment of human breast cancer MDA-MB-231 cells[J]. Am J Transl Res, 2015, 7(9): 1660-1674.
pmid: 26550465 |
[14] |
WANG T, ZHANG Z H, WANG K, et al. Inhibitory effects of BMP9 on breast cancer cells by regulating their interaction with pre-adipocytes/adipocytes[J]. Oncotarget, 2017, 8(22): 35890-35901.
doi: 10.18632/oncotarget.16271 pmid: 28415788 |
[15] |
REN W, SUN X X, WANG K, et al. BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression[J]. Mol Biol Rep, 2014, 41(3): 1373-1383.
doi: 10.1007/s11033-013-2982-8 pmid: 24413988 |
[16] |
LI S, DAI H Y, HE Y, et al. BMP9 inhibits the growth of breast cancer cells by downregulation of the PI3K/Akt signaling pathway[J]. Oncol Rep, 2018, 40(3): 1743-1751.
doi: 10.3892/or.2018.6572 pmid: 30015950 |
[17] |
OUARNÉ M, BOUVARD C, BONEVA G, et al. BMP9, but not BMP10, acts as a quiescence factor on tumor growth, vessel normalization and metastasis in a mouse model of breast cancer[J]. J Exp Clin Cancer Res, 2018, 37(1): 209.
doi: 10.1186/s13046-018-0885-1 pmid: 30165893 |
[18] |
NEVES REBELLO ALVES L, DUMMER MEIRA D, POPPE MERIGUETI L, et al. Biomarkers in breast cancer: An old story with a new end[J]. Genes, 2023, 14(7): 1364.
doi: 10.3390/genes14071364 |
[19] |
RANDO O J, CHANG H Y. Genome-wide views of chromatin structure[J]. Annu Rev Biochem, 2009, 78: 245-271.
doi: 10.1146/annurev.biochem.78.071107.134639 pmid: 19317649 |
[20] | WEI C, DENG X G, GAO S D, et al. Cantharidin inhibits proliferation of liver cancer by inducing DNA damage via KDM4A-dependent histone H3K36 demethylation[J]. Evid Based Complement Alternat Med, 2022, 2022: 2197071. |
[21] |
SUN S S, YANG F J, ZHU Y C, et al. RETRACTED: KDM4A promotes the growth of non-small cell lung cancer by mediating the expression of Myc via DLX5 through the Wnt/β-catenin signaling pathway[J]. Life Sci, 2020, 262: 118508.
doi: 10.1016/j.lfs.2020.118508 |
[22] |
CHEN M, JIANG Y H, SUN Y B. KDM4A-mediated histone demethylation of SLC7A11 inhibits cell ferroptosis in osteosarcoma[J]. Biochem Biophys Res Commun, 2021, 550: 77-83.
doi: 10.1016/j.bbrc.2021.02.137 |
[23] | XIONG J, NIE M F, FU C, et al. Hypoxia enhances HIF1α transcription activity by upregulating KDM4A and mediating H3K9me3, thus inducing ferroptosis resistance in cervical cancer cells[J]. Stem Cells Int, 2022, 2022: 1608806. |
[24] | LI Y, WANG Y N, XIE Z, et al. JMJD2A facilitates growth and inhibits apoptosis of cervical cancer cells by downregulating tumor suppressor miR-491-5p[J]. Mol Med Rep, 2019, 19(4): 2489-2496. |
[25] |
LIN X, QIU W X, XIAO Y Y, et al. MiR-199b-5p suppresses tumor angiogenesis mediated by vascular endothelial cells in breast cancer by targeting ALK1[J]. Front Genet, 2019, 10: 1397.
doi: 10.3389/fgene.2019.01397 pmid: 32082362 |
[26] |
REN W, LIU Y H, WAN S H, et al. BMP9 inhibits proliferation and metastasis of HER2-positive SK-BR-3 breast cancer cells through ERK1/2 and PI3K/AKT pathways[J]. PLoS One, 2014, 9(5): e96816.
doi: 10.1371/journal.pone.0096816 |
[1] | ZHANG Qi, XIU Bingqiu, WU Jiong. Progress of important clinical research of breast cancer in China in 2023 [J]. China Oncology, 2024, 34(2): 135-142. |
[2] | ZHANG Siyuan, JIANG Zefei. Important research progress in clinical practice for advanced breast cancer in 2023 [J]. China Oncology, 2024, 34(2): 143-150. |
[3] | WANG Zhaobu, LI Xing, YU Xinmiao, JIN Feng. Important research progress in clinical practice for early breast cancer in 2023 [J]. China Oncology, 2024, 34(2): 151-160. |
[4] | LUO Yang, SUN Tao, SHAO Zhimin, CUI Jiuwei, PAN Yueyin, ZHANG Qingyuan, CHENG Ying, LI huiping, YANG Yan, YE Changsheng, YU Guohua, WANG Jingfen, LIU Yunjiang, LIU Xinlan, ZHOU Yuhong, BAI Yuju, GU Yuanting, WANG Xiaojia, XU Binghe, SONG Lihua. Efficacy, metabolic characteristics, safety and immunogenicity of AK-HER2 compared with reference trastuzumab in patients with metastatic HER2-positive breast cancer: a multicenter, randomized, double-blind phase Ⅲ equivalence trial [J]. China Oncology, 2024, 34(2): 161-175. |
[5] | HU Xiaoyu, CAI Yuwen, YE Fugui, SHAO Zhimin, HU Weigang, YU Keda. Impact of BRCA1/2 germline mutation on the incidence of second primary cancer following postoperative radiotherapy in patients with triple-negative breast cancer [J]. China Oncology, 2024, 34(2): 185-190. |
[6] | JIN Yizi, LIN Mingxi, ZHANG Jian. Receptor discordance between primary breast cancer and liver metastases [J]. China Oncology, 2023, 33(9): 834-843. |
[7] | YANG Zhongyi, XU Xiaoping, WANG Mingwei, ZHANG Yongping, YANG Jianwei, CHEN Yue, XU Wengui, LI Yaming, ZHANG Yingjian, SONG Shaoli. The specification and use of 18F-FES PET in breast cancer [J]. China Oncology, 2023, 33(8): 801-808. |
[8] | WANG Ruoxi, JI Peng, GONG Yue, CHEN Sheng. Response rate and clinical outcome of HER2-low breast cancer after neoadjuvant therapy: a single-center retrospective study [J]. China Oncology, 2023, 33(7): 686-692. |
[9] | WU Siyu, LI Junjie, SHAO Zhimin. Development history and research progress of sentinel lymph node biopsy in breast cancer [J]. China Oncology, 2023, 33(6): 551-559. |
[10] | BI Zhao, WANG Yongsheng. New concept of de-escalation management strategy in breast cancer patients with 1-2 positive sentinel lymph nodes [J]. China Oncology, 2023, 33(6): 560-565. |
[11] | ZHAO Qian, LING Yunxiao, LIU Guangyu. Recent advances and perspectives in the application of repeat sentinel lymph node biopsy in breast cancer patients underwent breast-conserving surgery [J]. China Oncology, 2023, 33(6): 566-573. |
[12] | CONG Binbin, CAO Xiaoshan, WANG Chuanjian, QIU Pengfei, SUN Xiao, CHEN Peng, LIU Yanbing, ZHAO Tong, ZHANG Zhaopeng, SHI Zhiqiang, BI Zhao, WANG Yongsheng. Feasibility analysis of sentinel lymph node biopsy in breast cancer with axilla negative evaluation by physical examination but suspicious lymph nodes finding on preoperative imaging and metastasis confirmed with biopsy [J]. China Oncology, 2023, 33(6): 574-580. |
[13] | REN Hengyu, HAO Shuang, CHEN Jiajian, YANG Benlong, CAO Ayong, LIU Guangyu, SHAO Zhimin, WU Jiong. Current status and focus of breast reconstruction research in China and abroad: a bibliometric study [J]. China Oncology, 2023, 33(6): 581-588. |
[14] | CHEN Luyan, WANG Lixue, FU Peifen. The value of surgery in the patients with de novo stage Ⅳ breast cancer [J]. China Oncology, 2023, 33(5): 431-436. |
[15] | YANG Wenxiao, GUO Linwei, LING Hong, HU Xin. Characterization of immune microenvironment identifies prognostic and immunotherapy benefit for trastuzumab-based therapy [J]. China Oncology, 2023, 33(5): 484-498. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
沪ICP备12009617
Powered by Beijing Magtech Co. Ltd