KDM4A promotes the migration and invasion of breast cancer cell line MDA-MB-231 by downregulating BMP9

doi:10.19401/j.cnki.1007-3639.2024.02.005

Abstract

Abstract:

Background and purpose: Exogenous bone morphogenetic protein 9 (BMP9) inhibits the malignant progression of human breast cancer, but its expression is often abnormally low in breast cancer. In this study, we intended to explore the expression and role of epigenetically-modified histone lysine-specific demethylase 4A (KDM4A) in breast cancer, and to investigate the relationship between KDM4A and BMP9 and its possible regulatory mechanism. Methods: The expression of KDM4A in breast cancer and its relationship with BMP9 were analyzed by bioinformatics and verified by real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR) and Western blot. Chromatin immunoprecipitation (ChIP) verified the regulatory role of KDM4A on BMP9, and RNA stability experiments and CHX protein stability experiments verified the effect of KDM4A in BMP9 expression. Exogenous recombinant MDA-MB-231 cells transfected with KDM4A small interfering RNA (siKDM4A) or infected with siBMP9 adenovirus (Ad-siBMP9) were constructed using RNA interference technology and adenoviruses knocking down BMP9, and the migratory and invasive abilities of the cells were detected by scratch healing assay and transwell assay, respectively. Results: Bioinformatics analysis showed that the expression of KDM4A was significantly higher in breast cancer than in normal tissues, and there was a negative correlation between the expression of KDM4A and that of BMP9 in breast cancer; RTFQ-PCR and Western blot showed that KDM4A was highly expressed in different breast cancer cell lines, and the knockdown of KDM4A significantly up-regulated BMP9. ChIP experiment confirmed that KDM4A could be significantly enriched in the promoter region of BMP9 gene, reducing its histone lysine 36 position instead of position 4 methyl status, thus silencing the expression of BMP9. RNA stability assay and CHX protein stability assay confirmed that KDM4A had no significant effect on the mRNA of BMP9, but could affect its protein degradation. After knocking down KDM4A, the migration and invasion abilities of breast cancer cells MDA-MB-231 were significantly inhibited, and this effect could be partially reversed by knocking down BMP9. Conclusion: KDM4A is highly expressed in breast cancer and breast cancer cell MDA-MB-231, and can silence its expression by down-regulating the level of histone methylation in the promoter region of the BMP9 gene, as well as affecting the stability of BMP9 at the protein level rather than at the level of mRNA, and promoting the migration and invasion of breast cancer.

Key words: Breast cancer, Lysine-specific demethylase 4A, Histone demethylation, Bone morphogenetic protein 9

CLC Number:

R737.9

CHEN Yuanxiang, YU Tao, YANG Shiyu, ZENG Tao, WEI Lan, ZHANG Yan. KDM4A promotes the migration and invasion of breast cancer cell line MDA-MB-231 by downregulating BMP9[J]. China Oncology, 2024, 34(2): 176-184.

Figures/Tables 6

Tab. 1

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig.5

References 26

[1]	HOUGHTON S C, HANKINSON S E. Cancer progress and priorities: breast cancer[J]. Cancer Epidemiol Biomarkers Prev, 2021, 30(5): 822-844. doi: 10.1158/1055-9965.EPI-20-1193
[2]	BARZAMAN K, KARAMI J, ZAREI Z, et al. Breast cancer: biology, biomarkers, and treatments[J]. Int Immunopharmacol, 2020, 84: 106535. doi: 10.1016/j.intimp.2020.106535
[3]	LANDSKRON G, DE LA FUENTE M, THUWAJIT P, et al. Chronic inflammation and cytokines in the tumor microenvironment[J]. J Immunol Res, 2014, 2014: 149185.
[4]	KONG R N, GAO J, JI L M, et al. Iguratimod ameliorates rheumatoid arthritis progression through regulating miR-146a mediated IRAK1 expression and TRAF6/JNK1 pathway: an in vivo and in vitro study[J]. Clin Exp Rheumatol, 2021, 39(2): 289-303. doi: 10.55563/clinexprheumatol/urhbn0
[5]	谭秋芬, 胡惠军. FEN1、GTF2IP23、KDM4A在乳腺癌组织中的表达研究[J]. 国际检验医学杂志, 2023, 44(3): 311-315.
	TAN Q F, HU H J. Expression and correlation of FEN1, GTF2IP23, and KDM4A in breast cancer tissues[J]. Int J Lab Med, 2023, 44(3): 311-315.
[6]	LEE J, THOMPSON J R, BOTUYAN M V, et al. Distinct binding modes specify the recognition of methylated histones H3K4 and H4K20 by JMJD2A-tudor[J]. Nat Struct Mol Biol, 2008, 15(1): 109-111. doi: 10.1038/nsmb1326 pmid: 18084306
[7]	CHEN Y C, LIU X R, LI Y K, et al. Lung cancer therapy targeting histone methylation: opportunities and challenges[J]. Comput Struct Biotechnol J, 2018, 16: 211-223.
[8]	WANG G L, WEN B Q, DENG Z C, et al. Endothelial progenitor cells stimulate neonatal lung angiogenesis through FOXF1-mediated activation of BMP9/ACVRL1 signaling[J]. Nat Commun, 2022, 13(1): 2080. doi: 10.1038/s41467-022-29746-y pmid: 35440116
[9]	XU J Z, ZHOU Y M, ZHANG L L, et al. BMP9 reduces age-related bone loss in mice by inhibiting osteoblast senescence through Smad1-Stat1-P21 axis[J]. Cell Death Discov, 2022, 8(1): 254. doi: 10.1038/s41420-022-01048-8
[10]	HAN Y L, PAN Q Z, GUO Z X, et al. BMP9-induced vascular normalisation improves the efficacy of immunotherapy against hepatitis B virus-associated hepatocellular carcinoma[J]. Clin Transl Med, 2023, 13(5): e1247. doi: 10.1002/ctm2.1247 pmid: 37132170
[11]	CHEN H, NIO K, TANG H, et al. BMP9-ID1 signaling activates HIF-1α and VEGFA expression to promote tumor angiogenesis in hepatocellular carcinoma[J]. Int J Mol Sci, 2022, 23(3): 1475. doi: 10.3390/ijms23031475
[12]	YU H M, CHEN Y X, LANG L, et al. BMP9 promotes autophagy and inhibits migration and invasion in breast cancer cells through the c-Myc/SNHG3/mTOR signaling axis[J]. Tissue Cell, 2023, 82: 102073. doi: 10.1016/j.tice.2023.102073
[13]	WANG W, WENG Y G, REN W, et al. Biological roles of human bone morphogenetic protein 9 in the bone microenvironment of human breast cancer MDA-MB-231 cells[J]. Am J Transl Res, 2015, 7(9): 1660-1674. pmid: 26550465
[14]	WANG T, ZHANG Z H, WANG K, et al. Inhibitory effects of BMP9 on breast cancer cells by regulating their interaction with pre-adipocytes/adipocytes[J]. Oncotarget, 2017, 8(22): 35890-35901. doi: 10.18632/oncotarget.16271 pmid: 28415788
[15]	REN W, SUN X X, WANG K, et al. BMP9 inhibits the bone metastasis of breast cancer cells by downregulating CCN2 (connective tissue growth factor, CTGF) expression[J]. Mol Biol Rep, 2014, 41(3): 1373-1383. doi: 10.1007/s11033-013-2982-8 pmid: 24413988
[16]	LI S, DAI H Y, HE Y, et al. BMP9 inhibits the growth of breast cancer cells by downregulation of the PI3K/Akt signaling pathway[J]. Oncol Rep, 2018, 40(3): 1743-1751. doi: 10.3892/or.2018.6572 pmid: 30015950
[17]	OUARNÉ M, BOUVARD C, BONEVA G, et al. BMP9, but not BMP10, acts as a quiescence factor on tumor growth, vessel normalization and metastasis in a mouse model of breast cancer[J]. J Exp Clin Cancer Res, 2018, 37(1): 209. doi: 10.1186/s13046-018-0885-1 pmid: 30165893
[18]	NEVES REBELLO ALVES L, DUMMER MEIRA D, POPPE MERIGUETI L, et al. Biomarkers in breast cancer: An old story with a new end[J]. Genes, 2023, 14(7): 1364. doi: 10.3390/genes14071364
[19]	RANDO O J, CHANG H Y. Genome-wide views of chromatin structure[J]. Annu Rev Biochem, 2009, 78: 245-271. doi: 10.1146/annurev.biochem.78.071107.134639 pmid: 19317649
[20]	WEI C, DENG X G, GAO S D, et al. Cantharidin inhibits proliferation of liver cancer by inducing DNA damage via KDM4A-dependent histone H3K36 demethylation[J]. Evid Based Complement Alternat Med, 2022, 2022: 2197071.
[21]	SUN S S, YANG F J, ZHU Y C, et al. RETRACTED: KDM4A promotes the growth of non-small cell lung cancer by mediating the expression of Myc via DLX5 through the Wnt/β-catenin signaling pathway[J]. Life Sci, 2020, 262: 118508. doi: 10.1016/j.lfs.2020.118508
[22]	CHEN M, JIANG Y H, SUN Y B. KDM4A-mediated histone demethylation of SLC7A11 inhibits cell ferroptosis in osteosarcoma[J]. Biochem Biophys Res Commun, 2021, 550: 77-83. doi: 10.1016/j.bbrc.2021.02.137
[23]	XIONG J, NIE M F, FU C, et al. Hypoxia enhances HIF1α transcription activity by upregulating KDM4A and mediating H3K9me3, thus inducing ferroptosis resistance in cervical cancer cells[J]. Stem Cells Int, 2022, 2022: 1608806.
[24]	LI Y, WANG Y N, XIE Z, et al. JMJD2A facilitates growth and inhibits apoptosis of cervical cancer cells by downregulating tumor suppressor miR-491-5p[J]. Mol Med Rep, 2019, 19(4): 2489-2496.
[25]	LIN X, QIU W X, XIAO Y Y, et al. MiR-199b-5p suppresses tumor angiogenesis mediated by vascular endothelial cells in breast cancer by targeting ALK1[J]. Front Genet, 2019, 10: 1397. doi: 10.3389/fgene.2019.01397 pmid: 32082362
[26]	REN W, LIU Y H, WAN S H, et al. BMP9 inhibits proliferation and metastasis of HER2-positive SK-BR-3 breast cancer cells through ERK1/2 and PI3K/AKT pathways[J]. PLoS One, 2014, 9(5): e96816. doi: 10.1371/journal.pone.0096816

Primer	Sequence (5'→3')
siRNA negative control	F: UUCUCCGAACGUGUCACGUTT
siRNA negative control	R: ACGUGACACGUUCGGAGAATT
siKDM4A	F: CCGAGUUUGUCUUGAAAUATT
siKDM4A	R: UAUUUCAAGACAAACUCGGTT
BMP9	F: CGTCCAACATTGTGCGGAG
BMP9	R: GACAGGAGACATAGAGTCGGAG
KDM4A	F: CCTCACTGCGCTGTCTGTAT
KDM4A	R: CCAGTCGAAGTGAAGCACAT
GAPDH	F: CAGCGACACCCACTCCTC
GAPDH	R: TGAGGTCCACCACCCTGT