China Oncology ›› 2024, Vol. 34 ›› Issue (8): 715-725.doi: 10.19401/j.cnki.1007-3639.2024.08.001
• Article • Previous Articles Next Articles
YAN Yan(), ZHOU Liqing(
), XIA Jianhong, MA Tingting
Received:
2023-12-27
Revised:
2024-04-12
Online:
2024-08-30
Published:
2024-09-10
Share article
CLC Number:
YAN Yan, ZHOU Liqing, XIA Jianhong, MA Tingting. TCF7 transcriptional activation of MACC1 regulates aerobic glycolysis and promotes oxaliplatin resistance in rectal cancer[J]. China Oncology, 2024, 34(8): 715-725.
Tab. 1
RTFQ-PCR primer sequences"
Gene primer | Sequence |
---|---|
MACC1 | |
Forward primer | 5’- TTCTTTTGATTCCTCCCCTCA -3’ |
Reverse primer | 5’- ACTCTCATGGGCATGTGCTC -3’ |
TCF7 | |
Forward primer | 5’-CAAGCAGAGTCCAAGGCAGA-3’ |
Reverse primer | 5’-AGGATCTGGTTGATGGCAGC-3’ |
β-actin | |
Forward primer | 5’- GACCTCTATGCCAACACAGT3 -3’ |
Reverse primer | 5’- AGTACTTGCGCTCAGGAGGA -3’ |
Fig. 1
Upregulation of MACC1 expression in rectal cancer A: Analyze the expression level of MACC1 in normal tissues adjacent to cancer tissues and rectal cancer tissues using the TCGA database; B: RTFQ-PCR analysis of MACC1 expression in Caco-2, SW480, SW837, and normal rectal epithelial cells FHC. *: P<0.05, compared with each other."
Fig. 2
MACC1 promotes drug resistance in rectal cancer cells A: The expression of MACC1 in oxaliplatin sensitive rectal cancer cell lines and oxaliplatin resistant rectal cancer cell lines; B: Detecting the transfection efficiency of sh-MACC1; C: Detection of the activity of rectal cancer oxaliplatin resistant cell lines after knocking down MACC1; D-E: Detection of decreased proliferation ability of rectal cancer oxaliplatin resistant cells after knocking down MACC1; F: Detection of the IC50 value of rectal cancer oxaliplatin resistant cells after knocking down MACC1. *: P<0.05, compared with each other."
Fig. 3
MACC1 promotes oxaliplatin resistance in rectal cancer cells by regulating aerobic glycolysis A: GESA analysis revealed that MACC1 was enriched in glycolytic signaling pathways; B: The correlation between MACC1 and glycolytic marker genes; C: Detect the cell viability of rectal cancer oxaliplatin resistant cells after expressing MACC1 and adding 2-DG; D: Detect the ECAR value of rectal cancer cells after oe-MACC1+DMSO; E: Glucose consumption and lactate production in rectal cancer oxaliplatin resistant cells after oe-MACC1+DMSO treatment; F: Detecting the expression of key protein HK2 in the glycolytic pathway; G: Colony formation assay was used to detect the proliferation ability of rectal cancer oxaliplatin resistant cells treated with oe-MACC1 and oe-MACC1+2-DG; H: Detect the IC50 values of rectal cancer oxaliplatin resistant cells treated with different concentrations of oxaliplatin.*: P<0.05, compared with each other."
Fig. 4
TCF7 transcription regulation of MACC1 A: ChIPBase predicted transcription factors that bind to the promoter region of MACC1; B: There was a positive correlation between TCF7 and MACC1; C: The expression level of TCF7 in rectal cancer tissue; D: The expression level of TCF7 in rectal cancer cells and oxaliplatin resistant cells; E: The binding motif of TCF7 and MACC1; F: ChIP and dual luciferase assays were performed to detect the key binding points of MACC1 and TCF7 in SW837/L-OHP cells.*: P<0.05, compared with each other."
Fig. 5
TCF7/MACC1 regulated aerobic glycolysis pathway and affects oxaliplatin resistance in rectal cancer cells A: Detection of transfection efficiency in rectal cancer oxaliplatin-resistant cells transfected with knockdown TCF7 plasmid, knockdown TCF7 and overexpressing MACC1 plasmid, transfected with overexpression of TCF7 plasmid, overexpression of TCF7 and knockdown of MACC1 plasmid rectal cancer oxaliplatin-resistant cells; B: Transfection of rectal cancer oxaliplatin-resistant cells with knockdown TCF7 plasmid, knockdown TCF7 and overexpression of MACC1 plasmid, cell viability of rectal cancer oxaliplatin-resistant cells transfected with overexpression of TCF7 plasmid, overexpression of TCF7 and knockdown of MACC1 plasmid; C-D: Detection of ECAR values of rectal cancer oxaliplatin-resistant cells in each treatment group; E: Glucose consumption as well as lactic acid production of rectal cancer oxaliplatin-resistant cells in each treatment group; F: Western blot assay for the expression of key proteins in the glycolytic pathway; G: SW837/L -OHP cells colony forming ability under different treatments; H: IC50 values of SW837/L-OHP cells under different concentrations of oxaliplatin; *: P<0.05, compared with each other."
[1] | ZHENG R S, ZHANG S W, ZENG H M, et al. Cancer incidence and mortality in China, 2016[J]. J Natl Cancer Cent, 2022, 2(1): 1-9. |
[2] |
上海市抗癌协会大肠癌专业委员会. 结直肠癌早筛、早诊、早治上海方案(2023年版)[J]. 中国癌症杂志, 2024, 34(1): 13-66.
doi: 10.19401/j.cnki.1007-3639.2024.01.002 |
Colorectal Cancer Special Committee of Shanghai Anti-Cancer Association. Shanghai plan for early screening, diagnosis and treatment of colorectal cancer (2023 edition)[J]. China Oncol, 2024, 34(1): 13-66. | |
[3] | YANG Y, WANG H Y, CHEN Y K, et al. Current status of surgical treatment of rectal cancer in China[J]. Chin Med J, 2020, 133(22): 2703-2711. |
[4] | WANG Y Q, SHEN L J, WAN J F, et al. Neoadjuvant chemoradiotherapy combined with immunotherapy for locally advanced rectal cancer: a new era for anal preservation[J]. Front Immunol, 2022, 13: 1067036. |
[5] | CIARDIELLO F, CIARDIELLO D, MARTINI G, et al. Clinical management of metastatic colorectal cancer in the era of precision medicine[J]. CA Cancer J Clin, 2022, 72(4): 372-401. |
[6] |
TATARYN B, KRYZHANIVSKA A, HOLOTIUK V, et al. Chemotherapy in rectal cancer[J]. Wiad Lek, 2021, 74(8): 1816-1823.
pmid: 34537726 |
[7] |
KIM J K, MARCO M R, ROXBURGH C S D, et al. Survival after induction chemotherapy and chemoradiation versus chemoradiation and adjuvant chemotherapy for locally advanced rectal cancer[J]. Oncologist, 2022, 27(5): 380-388.
doi: 10.1093/oncolo/oyac025 pmid: 35278070 |
[8] | ZHANG Z Y, YAO Q Z, LIU H Y, et al. Metabolic reprogramming-associated genes predict overall survival for rectal cancer[J]. J Cell Mol Med, 2020, 24(10): 5842-5849. |
[9] | LIU C, JIN Y, FAN Z M. The mechanism of Warburg effect-induced chemoresistance in cancer[J]. Front Oncol, 2021, 11: 698023. |
[10] |
LIN J G, XIA L Z, OYANG L, et al. The POU2F1-ALDOA axis promotes the proliferation and chemoresistance of colon cancer cells by enhancing glycolysis and the pentose phosphate pathway activity[J]. Oncogene, 2022, 41(7): 1024-1039.
doi: 10.1038/s41388-021-02148-y pmid: 34997215 |
[11] | HOHMANN T, HOHMANN U, DEHGHANI F. MACC1-induced migration in tumors: current state and perspective[J]. Front Oncol, 2023, 13: 1165676. |
[12] | ZHANG Q, ZHANG B, SUN L N, et al. Cisplatin resistance in lung cancer is mediated by MACC1 expression through PI3K/AKT signaling pathway activation[J]. Acta Biochim Biophys Sin, 2018, 50(8): 748-756. |
[13] |
DUAN J M, CHEN L S, ZHOU M Y, et al. MACC1 decreases the chemosensitivity of gastric cancer cells to oxaliplatin by regulating FASN expression[J]. Oncol Rep, 2017, 37(5): 2583-2592.
doi: 10.3892/or.2017.5519 pmid: 28339092 |
[14] |
ZHEN T T, DAI S J, LI H, et al. MACC1 promotes carcinogenesis of colorectal cancer via β-catenin signaling pathway[J]. Oncotarget, 2014, 5(11): 3756-3769.
doi: 10.18632/oncotarget.1993 pmid: 25003996 |
[15] |
KORTÜM B, RADHAKRISHNAN H, ZINCKE F, et al. Combinatorial treatment with statins and niclosamide prevents CRC dissemination by unhinging the MACC1-β-catenin-S100A4 axis of metastasis[J]. Oncogene, 2022, 41(39): 4446-4458.
doi: 10.1038/s41388-022-02407-6 pmid: 36008464 |
[16] |
CHENG C Y, XIE Z H, LI Y H, et al. PTBP1 knockdown overcomes the resistance to vincristine and oxaliplatin in drug-resistant colon cancer cells through regulation of glycolysis[J]. Biomed Pharmacother, 2018, 108: 194-200.
doi: S0753-3322(18)33137-8 pmid: 30219676 |
[17] | LIU J, PAN C Q, GUO L H, et al. A new mechanism of trastuzumab resistance in gastric cancer: MACC1 promotes the Warburg effect via activation of the PI3K/AKT signaling pathway[J]. J Hematol Oncol, 2016, 9(1): 76. |
[18] | LI M X, CHE N, JIN Y, et al. CDKN3 overcomes bladder cancer cisplatin resistance via LDHA-dependent glycolysis reprogramming[J]. Onco Targets Ther, 2022, 15: 299-311. |
[19] | WAINBERG Z A, BEKAII-SAAB T, BOLAND P M, et al. First-line liposomal irinotecan with oxaliplatin, 5-fluorouraciland leucovorin (NALIRIFOX) in pancreatic ductal adenocarcinoma: a phase Ⅰ/Ⅱ study[J]. Eur J Cancer, 2021, 151: 14-24. |
[20] | PARK S H, LIM D H, SOHN T S, et al. A randomized phase Ⅲ trial comparing adjuvant single-agent S1, S-1 with oxaliplatin, and postoperative chemoradiation with S-1 and oxaliplatin in patients with node-positive gastric cancer after D2 resection: the ARTIST 2 trial[J]. Ann Oncol, 2021, 32(3): 368-374. |
[21] | KOBA R, FUJITA H, NISHIBORI M, et al. Quantitative evaluation of the intratumoral distribution of platinum in oxaliplatin-treated rectal cancer: in situ visualization of platinum via synchrotron radiation X-ray fluorescence spectrometry[J]. Int J Cancer, 2020, 146(9): 2498-2509. |
[22] | LI H F, WANG C M, LAN L X, et al. PARP1 inhibitor combined with oxaliplatin efficiently suppresses oxaliplatin resistance in gastric cancer-derived organoids via homologous recombination and the base excision repair pathway[J]. Front Cell Dev Biol, 2021, 9: 719192. |
[23] | PAN Z H, ZHENG J, ZHANG J B, et al. A novel protein encoded by exosomal CircATG4B induces oxaliplatin resistance in colorectal cancer by promoting autophagy[J]. Adv Sci, 2022, 9(35): e2204513. |
[24] | LI H, CHEN J H, LIU J, et al. CPT2 downregulation triggers stemness and oxaliplatin resistance in colorectal cancer via activating the ROS/Wnt/β-catenin-induced glycolytic metabolism[J]. Exp Cell Res, 2021, 409(1): 112892. |
[25] | LI N, LI Y, GAO H B, et al. Forkhead-box A3 (FOXA3) represses cancer stemness and partially potentiates chemosensitivity by targeting metastasis-associated in colon cancer 1 (MACC1) signaling pathway in colorectal cancer cells[J]. Curr Cancer Drug Targets, 2020. |
[26] | QIU X F, XU Q H, LIAO B L, et al. Circ-CCS regulates oxaliplatin resistance via targeting miR-874-3p/HK2 axis in colorectal cancer[J]. Histol Histopathol, 2023, 38(10): 1145-1156. |
[27] | LV M M, JIAO Y J, YANG B W, et al. MACC1 as a potential target for the treatment and prevention of breast cancer[J]. Biology, 2023, 12(3): 455. |
[28] |
LIN L, LIU Y T, PAN C Q, et al. Gastric cancer cells escape metabolic stress via the DLC3/MACC1 axis[J]. Theranostics, 2019, 9(7): 2100-2114.
doi: 10.7150/thno.29538 pmid: 31037159 |
[29] |
WANG X Y, ZHANG H Y, YANG H O, et al. Exosome-delivered circRNA promotes glycolysis to induce chemoresistance through the miR-122-PKM2 axis in colorectal cancer[J]. Mol Oncol, 2020, 14(3): 539-555.
doi: 10.1002/1878-0261.12629 pmid: 31901148 |
[30] | LIU H, LI D X, SUN L N, et al. Interaction of lncRNA MIR100HG with hnRNPA2B1 facilitates m6A-dependent stabilization of TCF7L2 mRNA and colorectal cancer progression[J]. Mol Cancer, 2022, 21(1): 74. |
[31] | GUO Y X, GUO Y Y, CHEN C, et al. Circ3823 contributes to growth, metastasis and angiogenesis of colorectal cancer: involvement of miR-30c-5p/TCF7 axis[J]. Mol Cancer, 2021, 20(1): 93. |
[32] | PENG Y, XIAO L P, RONG H X, et al. Single-cell profiling of tumor-infiltrating TCF1/TCF7+ T cells reveals a T lymphocyte subset associated with tertiary lymphoid structures/organs and a superior prognosis in oral cancer[J]. Oral Oncol, 2021, 119: 105348. |
[33] | LIU H Q, ZHANG H, LIU X Q, et al. Pancreatic stellate cells exploit Wnt/β-catenin/TCF7-mediated glutamine metabolism to promote pancreatic cancer cells growth[J]. Cancer Lett, 2023, 555: 216040. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
沪ICP备12009617
Powered by Beijing Magtech Co. Ltd