Correlations between expressions of DPD, LC3 and P62 in colorectal cancer and their clinical significance

doi:10.19401/j.cnki.1007-3639.2022.01.003

Abstract

Abstract:

Background and purpose: Colorectal cancer is one of the most common malignancies. The efficacy of 5-fluorouracil (5-FU) in the treatment of colorectal cancer is often affected by drug resistance or toxic side effects. Dihydropyrimidine dehydrogenase (DPD) is the key enzyme in the metabolism of 5-FU, and the expression or degradation rate of 5-FU may be a factor affecting the efficacy of 5-FU. Autophagy is an important pathway of intracellular protein degradation. This study aimed to detect the expression of microtubule-associated protein light chain 3 (LC3), P62 and DPD in colorectal cancer, and to explore their correlation and clinical significance, so as to provide a new way to reverse 5-FU resistance. Methods: Immunohistochemical envision method was used to detect the expressions of LC3, p62 and DPD in 157 colorectal cancer paraffin tissues archived by Department of Pathology, Binzhou Medical University Hospital from 2013 to 2014. Western blot and real-time fluorescence quantitative polymerase chain reaction (RTFQ-PCR) were used to detect the expressions of LC3, p62 and DPD in 44 colorectal cancer fresh tissues received by Department of Pathology, Binzhou Medical University Hospital in 2020. The correlation and clinical significance were analyzed. Results: The expressions of LC3, P62 and DPD were significantly higher in colorectal carcinoma than in normal tissues (P<0.05). The expressions of P62 was positively correlated with the expressions of DPD, and the expressions of LC3 was negatively correlated with the expressions of P62 and DPD (P<0.05). The expression of DPD was significantly higher in P62^-/LC3^- group than in the other three groups, while the expression of DPD was significantly lower in P62^-/LC3⁺ group than in the other three groups (P<0.05). The protein expression of DPD in P62⁺/LC3^- and P62⁺/LC3⁺ group were different, but the difference was not statistically significant (P>0.05). The expression of P62 was positively correlated with T stage and lymph node metastasis. The expression of LC3 was positively correlated with tumor size and T stage. The protein expression of DPD was closely related to histological type (P<0.05). LC3, P62, DPD and lymph node metastasis were related to the prognosis of colorectal cancer patients. All of them were independent risk factors for the prognosis of colorectal cancer. Conclusion: LC3 and p62 can affect the expression of DPD. Autophagy-lysosome pathway may be an important pathway of DPD degradation, which may affect the resistance of colorectal cancer to 5-FU through the degradation rate of DPD.

Key words: Colorectal cancer, Dihydropyrimidine dehydrogenase, Autophagy, Light chain 3, P62

CLC Number:

JIA Zhenzhen, HE Shuang, LI Yangyang, WEN Feifei, XU Xiaoyang, GUO Ningjie, WU Shuhua. Correlations between expressions of DPD, LC3 and P62 in colorectal cancer and their clinical significance[J]. China Oncology, 2022, 32(1): 24-33.

Figures/Tables 11

Tab. 1

Fig. 1

Tab. 2

Fig. 2

Tab. 3

Tab. 4

Tab. 5

Fig. 3

Tab. 6

Fig. 4

Tab. 7

References 25

[1]	CHEN W Q, LI H, SUN K X, et al. Report of cancer incidence and mortality in China, 2014[J]. Chin J Oncol, 2018, 40(1): 5-13.
[2]	BENSON A B, VENOOK A P, AL-HAWARY M M, et al. NCCN guidelines insights: colon cancer, version 2.2018[J]. J Natl Compr Canc Netw, 2018, 16(4): 359-369. doi: 10.6004/jnccn.2018.0021
[3]	LIN K, JIANG H, ZHUANG S S, et al. Long noncoding RNA LINC00261 induces chemosensitization to 5-fluorouracil by mediating methylation-dependent repression of DPYD in human esophageal cancer[J]. FASEB J, 2019, 33(2): 1972-1988. doi: 10.1096/fsb2.v33.2
[4]	CHEN L J, SHE X D, WANG T, et al. Overcoming acquired drug resistance in colorectal cancer cells by targeted delivery of 5-FU with EGF grafted hollow mesoporous silica nanoparticles[J]. Nanoscale, 2015, 7(33): 14080-14092. doi: 10.1039/C5NR03527A
[5]	SHARMA V, GUPTA S K, VERMA M. Dihydropyrimidine dehydrogenase in the metabolism of the anticancer drugs[J]. Cancer Chemother Pharmacol, 2019, 84(6): 1157-1166. doi: 10.1007/s00280-019-03936-w
[6]	CHAMOREY E, FRANCOIS E, ETIENNE M C, et al. DPD status and fluoropyrimidines-based treatment: high activity matters too[J]. BMC Cancer, 2020, 20(1): 436. doi: 10.1186/s12885-020-06907-0
[7]	ZHANG Y H, LUO D D, WAN S B, et al. S1PR2 inhibitors potently reverse 5-FU resistance by downregulating DPD expression in colorectal cancer[J]. Pharmacol Res, 2020, 155: 104717. doi: 10.1016/j.phrs.2020.104717
[8]	SHEN X M, ZHOU C, LIAN L, et al. Relationship between the DPD and TS mRNA expression and the response to S-1-based chemotherapy and prognosis in patients with advanced gastric cancer[J]. Cell Biochem Biophys, 2015, 71(3): 1653-1661. doi: 10.1007/s12013-014-0387-5
[9]	MAGNES T, MELCHARDT T, WEISS L, et al. Fluorouracil and dihydropyrimidine dehydrogenase genotyping[J]. J Clin Oncol, 2016, 34(20): 2433-2434. doi: 10.1200/JCO.2016.66.6057
[10]	ZHANG Y H, SHI W N, WU S H, et al. SphK2 confers 5-fluorouracil resistance to colorectal cancer via upregulating H3K56ac-mediated DPD expression[J]. Oncogene, 2020, 39(29): 5214-5227. doi: 10.1038/s41388-020-1352-y
[11]	YANG C G, CICCOLINI J, BLESIUS A, et al. DPD-based adaptive dosing of 5-FU in patients with head and neck cancer: impact on treatment efficacy and toxicity[J]. Cancer Chemother Pharmacol, 2011, 67(1): 49-56. doi: 10.1007/s00280-010-1282-4
[12]	TAKECHI T, FUJIOKA A, MATSUSHIMA E, et al. Enhancement of the antitumour activity of 5-fluorouracil (5-FU) by inhibiting dihydropyrimidine dehydrogenase activity (DPD) using 5-chloro-2, 4-dihydroxypyridine (CDHP) in human tumour cells[J]. Eur J Cancer, 2002, 38(9): 1271-1277. doi: 10.1016/S0959-8049(02)00048-5
[13]	刘柳, 吴淑华, 李扬扬, 等. 结直肠癌中HSF1、c-Jun与DPD表达的相关性及其临床意义[J]. 临床与实验病理学杂志, 2020, 36(11): 1261-1268.
	LIU L, WU S H, LI Y Y, et al. Correlation of HSF1, c-Jun and DPD expression in colorectal adenocarcinoma and their clinical significance[J]. Chin J Clin Exp Pathol, 2020, 36(11): 1261-1268.
[14]	NAM T, HAN J H, DEVKOTA S, et al. Emerging paradigm of crosstalk between autophagy and the ubiquitin-proteasome system[J]. Mol Cells, 2017, 40(12): 897-905.
[15]	LEVINE B, KROEMER G. Biological functions of autophagy genes: a disease perspective[J]. Cell, 2019, 176(1/2): 11-42. doi: 10.1016/j.cell.2018.09.048
[16]	MOORS T E, HOOZEMANS J J, INGRASSIA A, et al. Therapeutic potential of autophagy-enhancing agents in Parkinson’s disease[J]. Mol Neurodegener, 2017, 12(1): 11. doi: 10.1186/s13024-017-0154-3
[17]	LI Q, LIU Y, SUN M. Autophagy and Alzheimer’s disease[J]. Cell Mol Neurobiol, 2017, 37(3): 377-388. doi: 10.1007/s10571-016-0386-8
[18]	LI Y J, LEI Y H, YAO N, et al. Autophagy and multidrug resistance in cancer[J]. Chin J Cancer, 2017, 36(1): 52. doi: 10.1186/s40880-017-0219-2
[19]	YANG J W, ZHANG Q H, LIU T. Autophagy facilitates anticancer effect of 5-fluorouracil in HCT-116 cells[J]. J Cancer Res Ther, 2018, 14(Suppl): S1141-S1147.
[20]	YAO C W, KANG K A, PIAO M J, et al. Reduced autophagy in 5-fluorouracil resistant colon cancer cells[J]. Biomol Ther (Seoul), 2017, 25(3): 315-320. doi: 10.4062/biomolther.2016.069
[21]	ISLAM M, SOORO M, ZHANG P H. Autophagic regulation of p62 is critical for cancer therapy[J]. Int J Mol Sci, 2018, 19(5): 1405. doi: 10.3390/ijms19051405
[22]	LAMARK T, SVENNING S, JOHANSEN T. Regulation of selective autophagy: the p62/SQSTM1 paradigm[J]. Essays Biochem, 2017, 61(6): 609-624. doi: 10.1042/EBC20170035
[23]	JIN H, SEO G S, LEE S H. Isoliquiritigenin-mediated p62/SQSTM1 induction regulates apoptotic potential through attenuation of caspase-8 activation in colorectal cancer cells[J]. Eur J Pharmacol, 2018, 841: 90-97. doi: 10.1016/j.ejphar.2018.10.015
[24]	KUO W L, SHARIFI M N, LINGEN M W, et al. p62/SQSTM1 accumulation in squamous cell carcinoma of head and neck predicts sensitivity to phosphatidylinositol 3-kinase pathway inhibitors[J]. PLoS One, 2014, 9(3): e90171. doi: 10.1371/journal.pone.0090171
[25]	PARK J M, HUANG S B, WU T T, et al. Prognostic impact of Beclin 1, p62/sequestosome 1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy[J]. Cancer Biol Ther, 2013, 14(2): 100-107. doi: 10.4161/cbt.22954

Gene	Sequence
P62	Forward primer: AGCTGCCCTCAGCCCTCTA
	Reverse primer: GGCTTCTCTTCCCTCCATGTT
DPD	Forward primer: CCAAAGTGAAAGAAGCATTG
	Reverse primer: TGTCACGATGTCCTTATCAA
LC3	Forward primer: GGCGCTTACAGCTCAATGCT
	Reverse primer: CTCCTGGGAGGCATAGACCA
GAPDH	Forward primer: GGCTCTCCAGAACATCATCCCTGC
	Reverse primer: GGGTGTCGCTGTTGAAGTCAGAGG

Item	Case n	LC3	P62	DPD
Normal	157	21 (13.4)	20 (12.7)	33 (21.0)
Tumor	157	79 (50.3)^*	108 (68.8)^*	89 (56.7)^*

Item	Case	P62		r value	P value	LC3		r value	P value
Item	Case	-	+	r value	P value	-	+	r value	P value
DPD				0.160	0.045^*			-0.200	0.012^*
-	68	27	41			26	42
+	89	22	67			52	37

Item	Case	P62		r value	P value	DPD		r value	P value
Item	Case	-	+	r value	P value	-	+	r value	P value
LC3				-0.202	0.011^*			-0.200	0.012^*
-	78	17	61			26	52
+	79	32	47			42	37

Item	Case n	P62⁺/LC3⁺ group	P62⁺/LC3^– group	P62^–/LC3⁺ group	P62^–/LC3^– group
DPD
+	89	30 (63.8)	37 (60.7)	7 (24.2)	15 (88.2)
-	68	17 (36.2)^※△	24 (39.3)^※△	25 (75.8)^*#△	2 (11.8)^*#※