China Oncology ›› 2022, Vol. 32 ›› Issue (1): 24-33.doi: 10.19401/j.cnki.1007-3639.2022.01.003
• Article • Previous Articles Next Articles
JIA Zhenzhen, HE Shuang, LI Yangyang, WEN Feifei, XU Xiaoyang, GUO Ningjie, WU Shuhua()
Received:
2021-07-13
Revised:
2021-12-02
Online:
2022-01-30
Published:
2022-01-25
Contact:
WU Shuhua
E-mail:wsh6108@126.com
CLC Number:
JIA Zhenzhen, HE Shuang, LI Yangyang, WEN Feifei, XU Xiaoyang, GUO Ningjie, WU Shuhua. Correlations between expressions of DPD, LC3 and P62 in colorectal cancer and their clinical significance[J]. China Oncology, 2022, 32(1): 24-33.
Tab. 1
RTFQ-PCR primer sequence"
Gene | Sequence |
---|---|
P62 | Forward primer: AGCTGCCCTCAGCCCTCTA |
Reverse primer: GGCTTCTCTTCCCTCCATGTT | |
DPD | Forward primer: CCAAAGTGAAAGAAGCATTG |
Reverse primer: TGTCACGATGTCCTTATCAA | |
LC3 | Forward primer: GGCGCTTACAGCTCAATGCT |
Reverse primer: CTCCTGGGAGGCATAGACCA | |
GAPDH | Forward primer: GGCTCTCCAGAACATCATCCCTGC |
Reverse primer: GGGTGTCGCTGTTGAAGTCAGAGG |
Fig. 1
The expression of LC3, P62 and DPD in colorectal cancer and normal tissues A:LC3 was positive in colorectal carcinoma; B: P62 was positive in colorectal carcinoma; C: DPD was positive in colorectal carcinoma; D: LC3 was negative in normal mucosa; E: P62 was negative in normal mucosa; F: DPD was negative in normal mucosa."
Tab. 6
Correlation between the expression of LC3, P62 and DPD and clinicopathological features in colorectal cancer (n)"
Variable | Case | P62+ | r value | P value | LC3+ | r value | P value | DPD+ | r value | P value |
---|---|---|---|---|---|---|---|---|---|---|
Gender | 0.047 | 0.556 | -0.032 | 0.694 | 0.024 | 0.769 | ||||
Male | 81 | 54 | 42 | 45 | ||||||
Female | 76 | 54 | 37 | 44 | ||||||
Age/year | 0.061 | 0.452 | -0.022 | 0.786 | -0.061 | 0.452 | ||||
<60 | 56 | 36 | 29 | 34 | ||||||
≥60 | 101 | 72 | 50 | 55 | ||||||
Tumor size D/cm | 0.03 | 0.707 | 0.199 | 0.013* | 0.051 | 0.522 | ||||
<5 | 67 | 45 | 26 | 36 | ||||||
≥5 | 90 | 63 | 53 | 53 | ||||||
Pathological pattern | 0.099 | 0.215 | -0.036 | 0.655 | 0.219 | 0.006* | ||||
Tubular | 104 | 68 | 54 | 51 | ||||||
Tubular-mucinous | 21 | 16 | 9 | 14 | ||||||
Mucinous | 32 | 24 | 16 | 24 | ||||||
Differentiation | -0.062 | 0.439 | 0.032 | 0.689 | 0.053 | 0.511 | ||||
Well | 27 | 21 | 12 | 15 | ||||||
Moderately | 102 | 68 | 53 | 56 | ||||||
Poorly | 28 | 19 | 14 | 18 | ||||||
Infiltration | 0.206 | 0.009* | 0.189 | 0.018* | 0.03 | 0.709 | ||||
T1 | 10 | 8 | 3 | 7 | ||||||
T2 | 24 | 15 | 8 | 13 | ||||||
T3-4 | 123 | 91 | 68 | 69 | ||||||
Lymph node metastasis | 0.204 | 0.010* | -0.034 | 0.675 | 0.409 | 0.545 | ||||
No | 121 | 77 | 62 | 67 | ||||||
Yes | 36 | 31 | 17 | 22 |
Tab. 7
Multivariate analysis of prognosis in patients with colorectal cancer"
Item | B | SE | Wald | df | Exp (B) | 95.0% CI | P value | |
---|---|---|---|---|---|---|---|---|
Lower | Upper | |||||||
P62 | 0.372 | 0.180 | 4.257 | 1 | 1.451 | 1.019 | 2.067 | 0.039* |
LC3 | –0.417 | 0.177 | 5.579 | 1 | 0.659 | 0.466 | 0.931 | 0.018* |
DPD | 0.391 | 0.170 | 5.265 | 1 | 1.478 | 1.059 | 2.064 | 0.022* |
Age | 0.026 | 0.171 | 0.023 | 1 | 1.026 | 0.735 | 1.434 | 0.879 |
Gender | –0.204 | 0.173 | 1.393 | 1 | 0.816 | 0.581 | 1.144 | 0.238 |
Tumor Size | 0.199 | 0.174 | 1.304 | 1 | 1.220 | 0.867 | 1.716 | 0.253 |
Differentiation | –0.076 | 0.136 | 0.308 | 1 | 0.927 | 0.710 | 1.211 | 0.579 |
Pathological pattern | –0.163 | 0.105 | 2.427 | 1 | 0.849 | 0.691 | 1.043 | 0.119 |
Infiltration | 0.133 | 0.152 | 0.763 | 1 | 1.142 | 0.848 | 1.539 | 0.382 |
Lymph node metastasis | 0.455 | 0.202 | 5.064 | 1 | 1.577 | 1.060 | 2.344 | 0.024* |
[1] | CHEN W Q, LI H, SUN K X, et al. Report of cancer incidence and mortality in China, 2014[J]. Chin J Oncol, 2018, 40(1): 5-13. |
[2] |
BENSON A B, VENOOK A P, AL-HAWARY M M, et al. NCCN guidelines insights: colon cancer, version 2.2018[J]. J Natl Compr Canc Netw, 2018, 16(4): 359-369.
doi: 10.6004/jnccn.2018.0021 |
[3] |
LIN K, JIANG H, ZHUANG S S, et al. Long noncoding RNA LINC00261 induces chemosensitization to 5-fluorouracil by mediating methylation-dependent repression of DPYD in human esophageal cancer[J]. FASEB J, 2019, 33(2): 1972-1988.
doi: 10.1096/fsb2.v33.2 |
[4] |
CHEN L J, SHE X D, WANG T, et al. Overcoming acquired drug resistance in colorectal cancer cells by targeted delivery of 5-FU with EGF grafted hollow mesoporous silica nanoparticles[J]. Nanoscale, 2015, 7(33): 14080-14092.
doi: 10.1039/C5NR03527A |
[5] |
SHARMA V, GUPTA S K, VERMA M. Dihydropyrimidine dehydrogenase in the metabolism of the anticancer drugs[J]. Cancer Chemother Pharmacol, 2019, 84(6): 1157-1166.
doi: 10.1007/s00280-019-03936-w |
[6] |
CHAMOREY E, FRANCOIS E, ETIENNE M C, et al. DPD status and fluoropyrimidines-based treatment: high activity matters too[J]. BMC Cancer, 2020, 20(1): 436.
doi: 10.1186/s12885-020-06907-0 |
[7] |
ZHANG Y H, LUO D D, WAN S B, et al. S1PR2 inhibitors potently reverse 5-FU resistance by downregulating DPD expression in colorectal cancer[J]. Pharmacol Res, 2020, 155: 104717.
doi: 10.1016/j.phrs.2020.104717 |
[8] |
SHEN X M, ZHOU C, LIAN L, et al. Relationship between the DPD and TS mRNA expression and the response to S-1-based chemotherapy and prognosis in patients with advanced gastric cancer[J]. Cell Biochem Biophys, 2015, 71(3): 1653-1661.
doi: 10.1007/s12013-014-0387-5 |
[9] |
MAGNES T, MELCHARDT T, WEISS L, et al. Fluorouracil and dihydropyrimidine dehydrogenase genotyping[J]. J Clin Oncol, 2016, 34(20): 2433-2434.
doi: 10.1200/JCO.2016.66.6057 |
[10] |
ZHANG Y H, SHI W N, WU S H, et al. SphK2 confers 5-fluorouracil resistance to colorectal cancer via upregulating H3K56ac-mediated DPD expression[J]. Oncogene, 2020, 39(29): 5214-5227.
doi: 10.1038/s41388-020-1352-y |
[11] |
YANG C G, CICCOLINI J, BLESIUS A, et al. DPD-based adaptive dosing of 5-FU in patients with head and neck cancer: impact on treatment efficacy and toxicity[J]. Cancer Chemother Pharmacol, 2011, 67(1): 49-56.
doi: 10.1007/s00280-010-1282-4 |
[12] |
TAKECHI T, FUJIOKA A, MATSUSHIMA E, et al. Enhancement of the antitumour activity of 5-fluorouracil (5-FU) by inhibiting dihydropyrimidine dehydrogenase activity (DPD) using 5-chloro-2, 4-dihydroxypyridine (CDHP) in human tumour cells[J]. Eur J Cancer, 2002, 38(9): 1271-1277.
doi: 10.1016/S0959-8049(02)00048-5 |
[13] | 刘柳, 吴淑华, 李扬扬, 等. 结直肠癌中HSF1、c-Jun与DPD表达的相关性及其临床意义[J]. 临床与实验病理学杂志, 2020, 36(11): 1261-1268. |
LIU L, WU S H, LI Y Y, et al. Correlation of HSF1, c-Jun and DPD expression in colorectal adenocarcinoma and their clinical significance[J]. Chin J Clin Exp Pathol, 2020, 36(11): 1261-1268. | |
[14] | NAM T, HAN J H, DEVKOTA S, et al. Emerging paradigm of crosstalk between autophagy and the ubiquitin-proteasome system[J]. Mol Cells, 2017, 40(12): 897-905. |
[15] |
LEVINE B, KROEMER G. Biological functions of autophagy genes: a disease perspective[J]. Cell, 2019, 176(1/2): 11-42.
doi: 10.1016/j.cell.2018.09.048 |
[16] |
MOORS T E, HOOZEMANS J J, INGRASSIA A, et al. Therapeutic potential of autophagy-enhancing agents in Parkinson’s disease[J]. Mol Neurodegener, 2017, 12(1): 11.
doi: 10.1186/s13024-017-0154-3 |
[17] |
LI Q, LIU Y, SUN M. Autophagy and Alzheimer’s disease[J]. Cell Mol Neurobiol, 2017, 37(3): 377-388.
doi: 10.1007/s10571-016-0386-8 |
[18] |
LI Y J, LEI Y H, YAO N, et al. Autophagy and multidrug resistance in cancer[J]. Chin J Cancer, 2017, 36(1): 52.
doi: 10.1186/s40880-017-0219-2 |
[19] | YANG J W, ZHANG Q H, LIU T. Autophagy facilitates anticancer effect of 5-fluorouracil in HCT-116 cells[J]. J Cancer Res Ther, 2018, 14(Suppl): S1141-S1147. |
[20] |
YAO C W, KANG K A, PIAO M J, et al. Reduced autophagy in 5-fluorouracil resistant colon cancer cells[J]. Biomol Ther (Seoul), 2017, 25(3): 315-320.
doi: 10.4062/biomolther.2016.069 |
[21] |
ISLAM M, SOORO M, ZHANG P H. Autophagic regulation of p62 is critical for cancer therapy[J]. Int J Mol Sci, 2018, 19(5): 1405.
doi: 10.3390/ijms19051405 |
[22] |
LAMARK T, SVENNING S, JOHANSEN T. Regulation of selective autophagy: the p62/SQSTM1 paradigm[J]. Essays Biochem, 2017, 61(6): 609-624.
doi: 10.1042/EBC20170035 |
[23] |
JIN H, SEO G S, LEE S H. Isoliquiritigenin-mediated p62/SQSTM1 induction regulates apoptotic potential through attenuation of caspase-8 activation in colorectal cancer cells[J]. Eur J Pharmacol, 2018, 841: 90-97.
doi: 10.1016/j.ejphar.2018.10.015 |
[24] |
KUO W L, SHARIFI M N, LINGEN M W, et al. p62/SQSTM1 accumulation in squamous cell carcinoma of head and neck predicts sensitivity to phosphatidylinositol 3-kinase pathway inhibitors[J]. PLoS One, 2014, 9(3): e90171.
doi: 10.1371/journal.pone.0090171 |
[25] |
PARK J M, HUANG S B, WU T T, et al. Prognostic impact of Beclin 1, p62/sequestosome 1 and LC3 protein expression in colon carcinomas from patients receiving 5-fluorouracil as adjuvant chemotherapy[J]. Cancer Biol Ther, 2013, 14(2): 100-107.
doi: 10.4161/cbt.22954 |
[1] | MA Yifei , LIANG Xinjun , WEI Shaozhong . Prognostic value of inflammatory and immune markers in resectable colorectal cancer [J]. China Oncology, 2021, 31(9): 845-851. |
[2] | ZHU Yihui, LI Ting, HU Xichun. Clinical research progress and prospect of trastuzumab deruxtecan [J]. China Oncology, 2021, 31(8): 754-761. |
[3] | ZHANG Yingqiang , LIN Yansong . Application and research progress of 90 Y microspheres internal radiation therapy in colorectal cancer with liver metastasis [J]. China Oncology, 2021, 31(8): 762-768. |
[4] | HUA Qing, SHEN Xuefang, XU Pingbo . Effect of KLK8 on apoptosis of colorectal cancer cells by regulating EGF and its mechanism [J]. China Oncology, 2021, 31(5): 383-389. |
[5] | MA Weidong, WANG Tongtong, ZHU Qihang, YANG Haiou, LIN Dan. Mechanism of colorectal cancer cell exosome-derived circ_0044366 in regulating release of MMP2 in fibroblasts and promoting metastasis of colorectal cancer [J]. China Oncology, 2021, 31(5): 397-407. |
[6] | CHEN Xinning , HUANG Fei , SHEN Minna , YANG Yihui , WANG Beili , GUO Wei . Comparison of detection methods and analysis of influencing factors of somatic mutation in plasma of metastatic colorectal cancer patients [J]. China Oncology, 2021, 31(3): 192-197. |
[7] | CHEN Feier , ZHANG Feng , TAN Zhenyu , XIA Qinghua , BAO Shisan , TAO Kun , DONG Zhiheng . Correlation between interleukin 35 or interleukin 37 and clinicopathology and prognosis of colorectal cancer [J]. China Oncology, 2020, 30(6): 456-461. |
[8] | WU Chunxiao , GU Kai , GONG Yangming , ZHENG Rongshou , WANG Shaoming , CHEN Ru , ZHANG Siwei , SHI Yan , WEI Wenqiang , FU Chen , HE Jie . Analysis of incidence and mortality of colorectal cancer in China, 2015 [J]. China Oncology, 2020, 30(4): 241-245. |
[9] | ZHOU Changming , GUO Tianan , MO Miao , YUAN Jing , SHEN Jie , WANG Zezhou , HUANG Dan , ZHU Ji , LI Xinxiang , CAI Guoxiang , XU Ye , CAI Sanjun , ZHENG Ying . Survival report of 13.7 thousand surgical colorectal cancer patients from a large single hospital-based cancer registry [J]. China Oncology, 2020, 30(4): 246-253. |
[10] | KAI Jinyan , MA Qian , TONG Ying , XIE Suhong , HE Chengyan , SONG Lina , SUN Jing , ZHU Guangbo , LU Renquan , GUO Lin . Diagnostic value of serum fibrin degradation complex (DR-70) in patients with colorectal cancer [J]. China Oncology, 2020, 30(4): 293-298. |
[11] | ZHU Xiaojian, LIN Kang, BU Fanqin, LUO Chen, HUANG Chao, ZHU Zhengming. High expression of DJ-1 promotes growth and invasion of colorectal cancer cells via the cyclin D1/p53-MDM2-AKT signaling pathway [J]. China Oncology, 2020, 30(3): 208-216. |
[12] | FAN Shouren , WU Shuhua , LI Yangyang , XU Xiaoyang , HE Shuang , WEN Feifei , LIU Liu , GUO Ningjie , JIA Zhenzhen . The correlation between LC3 and tumor-associated macrophages in colorectal cancer and its clinical significance [J]. China Oncology, 2020, 30(11): 849-857. |
[13] | LI Menglei , ZHANG Jing , DAN Yibo , YANG Guang , YAO Yefeng , TONG Tong . Development and validation of a clinical-radiomics nomogram for preoperative prediction of lymph node metastasis in colorectal cancer [J]. China Oncology, 2020, 30(1): 49-56. |
[14] | WU Jia, ZHOU Jialiang. The use of cetuximab in the continuum of care for patients with metastatic colorectal cancer [J]. China Oncology, 2020, 30(1): 64-69. |
[15] | JIANG Jinsong, REN Ruobing, GENG Mei, LI Hao. Metronomic chemotherapy with capecitabine as maintenance following first-line induction chemotherapy in metastatic colorectal cancer [J]. China Oncology, 2019, 29(3): 218-222. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
沪ICP备12009617
Powered by Beijing Magtech Co. Ltd